Centro de Acúfenos Buenos Aires

Can caffeine make us healthy?

2011-12-25T19:55:00.000-08:00

We're always being told to cut down on caffeine for our wellbeing – yet new studies suggest it could protect against a range of diseases. Kate Hilpern filters fact from froth

For years we have been told to beware of caffeine. Now we seem to have swung in the opposite direction, with studies claiming that moderate amounts of coffee may reduce headaches and protect against diabetes, Alzheimer's and heart disease, among others. So where does the truth lie?

We don't all have the same reactions to caffeine, Mehul Dhinoja, a consultant cardiologist at BMI London Independent Hospital, says.

"Each of us has an enzyme in the liver that breaks down and metabolises caffeine. It's that process that enables caffeine to have its effect around the body," he says. "Some people are born with an enzyme that works extremely efficiently and others have quite the opposite. Because this isn't controlled in studies about caffeine, it's not surprising to find statistical contradictions."

Peter Rogers, head of experimental psychology, says some people are more sensitive to the effects of caffeine, while others develop a tolerance. "One of the things caffeine has been found to do is increase blood pressure and make your hands shake a little," he says. "But actually this depends if you're a person who regularly consumes caffeine."

You can even develop a dependence of caffeine so that without it, you can feel fatigued and headachey, he says. "That's why if coffee drinkers haven't had caffeine for a while – for example, overnight – the coffee they have in the morning is likely to make them feel more energetic and alert, while for a non-regular drinker, it will make them jittery."

So while some studies say coffee stimulates the brain and makes drinkers feel more awake, Rogers and his team have found the "caffeine high" may just be a reaction to the body craving the drug. Caffeine may even have radically different effects on the sexes. Studies from Bristol University have found that drinking caffeinated coffee boosted a woman's performance in stressful situations, but had the opposite effect on men, who became less confident and took longer to complete tasks once they had several coffees.

What caffeine is good for

Forget hair of the dog. If you want to cure a hangover, a good old cup of coffee and aspirin really is best, according to a new study from Thomas Jefferson University in Philadelphia. Confirming what many have suspected for years, the research found that the caffeine in coffee and the anti-inflammatory ingredients of aspirin reacted against the chemical compounds of ethanol, or pure alcohol, which – even in small doses – can bring on headaches.

Tim Grattan, who developed the technology for the new paracetamol and caffeine product, Panado Extra Advance, isn't surprised: "There's plenty of clinical evidence that shows caffeine actually speeds up the painkilling properties of various painkillers. In fact, caffeine has played a role in making our new product 37 per cent more tough on pain than ordinary paracetamol tablets."

Drinking lots of coffee can also boost sports performance by as much as 6 per cent – but, critically, only in any activity where muscles are not being worked to the limit, meaning coffee or tea could benefit a long-distance runner but not a sprinter.

Rob James, from the University of Coventry's department of Biomolecular and Sports Science, believes caffeine in the bloodstream may influence receptors on skeletal muscle, making a person temporarily more powerful. If you overdo it, fear not – caffeine can help here, too. A study from the University of Georgia found that caffeine can help reduce the soreness that discourages some people from keeping up their workouts.

What it's bad for

Contrary to popular opinion, one thing coffee doesn't do is sober you up – it may even further impair your judgement, scientists at Temple University in Philadelphia have found. Combining alcohol and caffeine at the same time produces a potentially lethal mix that makes it harder to realise you are drunk, according to the study published in Behavioural Neuroscience. Perhaps less of a surprise is the discovery that energy drinks – some of them, at least – are bad for our health. "There have been increasing instances of atrial fibrillation (AF), a heart-rhythm problem, among young people who consume large amounts of energy drinks," Dhinoja says. It's not just drinks that can cause this problem. In 2009, a 13-year-old boy needed hospital treatment after ingesting "energy" chewing gum that contained 320mg of caffeine – more than in three cups of coffee.

Large amounts of caffeine in pregnancy also appear to be risky. Back in 2008, the Food Standards Agency warned women to have no more than two cups of coffee a day after a study linked caffeine to low birth weight. Caffeine may affect your chances of getting pregnant in the first place, too, according to a Netherlands study that found that women who drank four cups of coffee a day were 26 per cent less likely than average to have conceived naturally.

Caffeine could even shrink some women's breasts. Swedish research found that too much of it can affect hormones, playing havoc with their bust size.

Cancer and heart disease

An analysis of 59 studies just published on the BioMed Central Cancer website suggests that coffee consumption may reduce your overall risk of getting cancer and that it may be inversely associated with the risk of bladder, breast, pharynx, pancreas and prostate cancers and leukaemia, among others. One study even discovered that caffeine can cut the risk of skin cancer by more than a third.

But women who drink more than four cups of coffee a day increase their risk of developing breast cancer by a third, according to Harvard University. A high caffeine intake can also increase the chance of developing larger tumours, which are harder to treat.

The jury is still out on caffeine's relationship with the heart, too. Arthur Klatsky, a cardiologist, and his team at the Kaiser Permanente Division of Research in California discovered that regular coffee drinkers were less likely to be treated in hospital for irregular heartbeats or rhythms. The more cups of coffee they drank each day, the less likely they were to suffer from the condition. Spanish research has even shown that women who drink three cups a day could reduce their risk of dying from heart disease by a quarter, whilst another study found that men who drank five or more cups a day were 44 per cent less likely to die from the disease.

Other factors

Women who drink tea were recently found by American researchers to be at greater risk of developing rheumatoid arthritis. Other studies have shown tea drinkers can halve their risk of dementia and cut their risk of a stroke. Yet the same cannot be said about coffee drinkers. "This highlights a really important point – that the other constituents in tea and coffee may have their very own impact on health and well-being," Rogers says.

Australian scientists found that drinking three to four cups of coffee a day can lower the risk of type 2 diabetes by 25 per cent, but those who drank decaffeinated coffee showed similar results. And a study of almost 50,000 men found that those who drank the most coffee were 60 per cent less likely to develop the most aggressive form of prostate cancer.

Should we give it up?

Doctors often tell patients to quit caffeine, but that may not be necessary, Rogers says. "It seems to me odd to be telling someone to give up something they enjoy and when there's no real evidence."

Rogers followed a group of people with tinnitus – a condition for which caffeine has traditionally been deemed by doctors as a big no-no. "We found that those who did give up caffeine didn't improve their condition in any way." He adds: "Not to undermine the importance of my own research, but tea and coffee are things to worry about so much less than if you're a smoker, overweight or have a poor diet."

Fuente: The Independent
http://www.independent.co.uk/life-style/food-and-drink/features/can-caffeine-make-us-healthy-2255635.html?
Fuente de la imagen: http://viviendosanos.com/wp-content/uploads/2...

Can caffeine make us healthy?

2011-12-25T19:50:00.000-08:00

Navarra Quartet, Wigmore Hall

2011-12-25T19:34:00.000-08:00

Beethoven’s deafness was a noisy affair, with his dying hearing-sensors sending dreadfully garbled messages to his brain, but you’d never know it from the magisterial poise of the music he went on writing.

Bedrich Smetana, on the other hand, made a deliberate choice to translate the tinnitus which heralded his deafness into an explicitly musical form.

The movement with which he concludes his String Quartet No 1 is marked ‘vivace’, and it really is vivacious until a sudden high E comes in like a dentist’s drill, bringing everything to a juddering halt, after which the instruments sound as if they are tiptoeing away.

image:bundanon.com.au

The young Navarra Quartet presented this moment with fine panache, after delivering a convincing account of this autobiographical work. ‘I wanted to paint in sounds the course of my life,’ wrote this Czech composer, and though the Prague chamber music society dismissed it as impossible to play, it is now deservedly one of the best-loved works in the chamber repertoire. The Navarras didn’t quite catch the heel-clicking precision needed for the first of the country dances, but in every other respect they did it proud, bringing burning intensity to the ‘in memoriam’ for the composer’s dead wife, and a generous warmth to its evocations of village life.

They had begun their concert with Haydn’s Quartet Opus 54 No 2, and whoever penned the unsigned programme-note – one of the players? – deserves praise for a singular piece of illumination. It pointed out that in Haydn’s day quartets were mostly played by amateurs at home, where there would at best be just one skilled violinist: this work’s Adagio – one of the most sublime Haydn ever wrote – calls for extreme expressiveness from the first violin, while the other instruments provide the simplest of backdrops.

In point of fact, though the rest of the work was ably played, we didn’t get that sublimity from the Navarras: they had bags of vitality, but not that subtle synergy which distinguishes the most seasoned quartets. And by ending with an underwhelming account of Beethoven’s late A minor Quartet, with its transcendent Adagio, they demonstrated how far they have yet to go. This is holy ground, and only those able to penetrate its chiaroscuro mysteries should tread it.

Fuente: The Independent
http://www.independent.co.uk/arts-entertainment/classical/reviews/navarra-quartet-wigmore-hall-2235798.html?origin=internalSearch

Being Ernest: John Walsh unravels the mystery behind Hemingway's suicide

2011-12-25T19:27:00.000-08:00

America's most celebrated writer, Ernest Hemingway, ended his life 50 years ago – in a manner his biographers have struggled to explain

Fifty years ago, in the early hours of Sunday 2 July, 1961, Ernest Hemingway, America's most celebrated writer and a titan of 20th-century letters, awoke in his house in the Sawtooth Mountains of Idaho, rose from his bed, taking care not to wake his wife Mary, unlocked the door of the storage room where he kept his firearms, and selected a double-barrelled shotgun with which he liked to shoot pigeons.

He took it to the front of the house and, in the foyer, put the twin barrels against his forehead, reached down, pushed his thumb against the trigger and blew his brains out.

His death was timed at 7am.

Witnesses who saw the body remarked that he had chosen from his wardrobe a favourite dressing gown that he called his "emperor's robe".

They might have been reminded of the words of Shakespeare's Cleopatra, just before she applied the asp to her flesh: "Give me my robe. Put on my crown; I have immortal longings in me".

His widow Mary told the media that it was an unfortunate accident, that Ernest had been cleaning one of his guns when it accidentally went off. The story was splashed on the front page of all American newspapers.

It took Mary Welsh Hemingway several months to admit that her husband's death was suicide; and it's taken nearly 50 years to piece together the reasons why this giant personality, this rumbustious man of action, this bullfighter, deep-sea fisherman, great white hunter, war hero, gunslinger and four-times-married, all-round tough guy, whom every red-blooded American male hero-worshipped, should do himself in.

How could he? Why would he? Successive biographers – AE Hochtner, Carlos Baker, KS Lynn, AJ Monnier, Anthony Burgess – have chewed over the available facts, his restless travelling, his many amours, the peaks and troughs of his writing career.

But eventually it took a psychiatrist from Houston, Texas, to hold up all the evidence to the light and announce his disturbing conclusions.

The idealised life of Ernest Hemingway, the one the writer himself wanted the world to buy, was simple: he was the perfect man, the perfect synthesis of brain and brawn.

Driven by a thirst for adventure, he was a swashbuckling, hard-drinking pugilist who loved being in the thick of the action, whether in the front line of battle or within charging distance of a water buffalo.

He also happened to be the finest writer around, disdaining the grandiose wordiness of Victorian prose for a clean, stripped-back simplicity, conveying emotion by what was not said as much as by what was.

Wounded on the Italian front in the First World War, he was a handsome convalescent who fell in love with a pretty nurse and wrote A Farewell to Arms as a result.

In the 1920s, he was at the forefront of American writers and artists who hung out in Paris, "being geniuses together". They included F Scott Fitzgerald, who (according to A Moveable Feast) once showed Hemingway his penis and confessed his worry that it was too small to satisfy his wife Zelda; Hemingway kindly reassured him it was OK.

In the 1930s, he went to Spain to fight for the republic against Franco and wrote For Whom the Bell Tolls, in which a brave American hero falls in love with a peasant guerrilla called Maria.

In the Second World War, he was at the Normandy landings and the liberation of Paris. After the war he retired with his fourth wife to Cuba, where he fished for marlins and wrote The Old Man and the Sea, won the Nobel Prize, was lionised wherever he went – but was killed in an unfortunate firearm accident.

That's the official story. In the years after his death, however, the jigsaw pieces of a counter-life gradually began to emerge. His war record, for instance. Hemingway was only 18 when he signed up for the First World War – but it was as a non-combatant. He had a defective left eye, inherited from his mother, which kept him out of battle. He went to Italy to man the Red Cross canteens and evacuate the wounded. Helping a wounded man to safety one evening, he was shot in the leg and hospitalised in Milan, with three other patients and 18 nurses. Though his dalliance with Sister Agnew von Kurovsky was unconsummated, he fell in love with European culture and manners, swanned about in an Italian cloak, drank wine and affected a clipped delivery borrowed from a British officer, Eric Dorman-Smith.

In Paris, where he enjoyed a temporary idyll with his first wife Hadley and their baby John (or "Bumby"), Hemingway started to make his name as a writer – but also to display dangerous mood swings, irascibility, spite and a compulsion to turn against those who helped him.

He dumped Hadley and the baby and took up with Pauline Pfeiffer, a decision for which he was racked with nightmares of guilt, and moved to Key West, Florida.

For some reason, he became obsessed with bullfighting: the glorification of blood, the spilt horse-guts, the matador's passes with the cape and sword, the art of killing.

In Death in the Afternoon, Hemingway seemed to be working out some personal philosophy about death, but it was hard to follow.

The critic Max Eastman complained that his prose style had become the equivalent of "false hair on the chest".

Unable to participate directly in killing bulls, Hemingway decamped to Mombasa where he could legitimately blaze away at lions and kudu.

Not content with land-based mayhem, he bought a 38-foot cruiser called the Pilar to fish, in Key West and Havana, for marlin and other aquatic creatures twice the size of himself.

Between 1928 and 1936, he seemed to spend months posing beside up-ended fish trophies, the self-burnished image of the muscular man of action, handsome, tanned, drinking with the sailors in Sloppy Joe's bar.

He went to Spain during the civil war, not to fight, like George Orwell, but because he was commissioned to report on it for the North American Newspaper Alliance – and because his new love, Martha Gellhorn, was going there.

He stressed many times that he wasn't taking sides, and didn't want to see the USA embroiled in a foreign war.

In Madrid, despite the bombardment, he had the time of his life – enjoying caviar and vodka at the Gaylord Hotel, the Russian HQ, making a movie called The Spanish Earth and supplying its gravelly commentary, writing his broadly fictional dispatches for newspapers that criticised them as "very inefficient".

He looked the part of a hunky warrior, but he was a lucky dilettante, who could have left Spain any time he liked.

He wrote a play about Madrid in 1936 called The Fifth Column, about Dorothy, a plucky female journalist, who falls for Philip, a tough, intrepid, hard-drinking spy masquerading as a war correspondent. Self-projection turned into self-parody.

When America entered the Second World War in 1944, Hemingway got himself to England on "priority war business" – writing pieces about the RAF for Collier's magazine. It was a tough assignment.

He took a room at the Dorchester, where he held court as the Great American Writer and went to parties, receiving compliments on his beardy, macho wonderfulness.

When he was concussed in a car accident that followed a drunken party with Robert Capa the photographer, Martha Gellhorn – who'd travelled to England in a ship packed with high explosives – visited him in hospital and laughed at his footling mock-heroics.

As though stung into action, he headed for the war, joining the invasion fleet to Normandy and, later, General Patton's armoured divisions.

He was a so-so war correspondent who was simultaneously a sort-of-warrior. At the liberation of Paris, he was found in a hotel with a small private army.

When asked to leave by a French general, he liberated the Traveller's Club and the Ritz, taking a room at the latter to entertain his new love, Mary Welsh...

It's easy to be spiteful about Hemingway.

All his posturing, his editing of the truth, his vainglorious fibbing can obscure his undoubted bravery.

He loved being in the thick of the war – the tank advance through the Ardennes, the Battle of the Bulge – dodging bullets, watching men being shot to hell all around him.

But it's hard to shake off the feeling that what he was doing wasn't bravery, but psychotic self-dramatisation.

And when you inspect the image of Hemingway-as-hero, you uncover an extraordinary sub-stratum of self-harming.

You discover that, for just over half of his life, Hemingway seemed hell-bent on destroying himself.

It was about the time he was finishing A Farewell to Arms, in 1928, when he learnt that his father Clarence had shot himself in the head with a Civil War revolver, that Hemingway's life first began to crack apart.

The most obvious external evidence was a succession of bizarre physical accidents, many of which were bashes on the head.

One, in Paris, left him with a split head needing nine stitches, after he yanked the chain in the bathroom, thinking it was the lavatory flush, and pulled the skylight down on top of him.

He became weirdly accident-prone. His car accident that occasioned his row with Martha saw him hurled through the windscreen, lacerating his scalp and requiring 57 stitches.

Three months later, he came flying off a motorbike evading German fire in Normandy. He suffered headaches, tinnitus, diplopia, showed speech and memory problems for months.

Back in Cuba after the war, he tore open his forehead on the rear-view mirror when his car skidded. Five years later, while drinking, he slipped on the deck of the Pilar, and concussed himself. Why, you'd almost think he was trying to emulate his late father, and his self-imposed head wound.

The most egregious injury, however, occurred in January 1954. He and Mary took off from Nairobi in a small plane, heading for the Belgian Congo.

Near Victoria Falls it crash-landed in a thorn thicket and Ernest sprained his shoulder. As rumours of his death spread, he and his companions were rescued and put in a 12-seater De Havilland Rapide which – incredibly – burst into flames on the runway.

Finding the door jammed, Hemingway volunteered to use his head as a battering ram, butted the door twice and got out.

He liked to present it as a classic example of superman pragmatism, but it nearly killed him.

He fractured his skull and lacerated his scalp; cerebrospinal fluid seeped from his ear.

In Nairobi he was diagnosed with grave overall concussion, temporary vision-loss in the right eye, deafness in left ear, paralysis of sphincter muscle, first degree burns on face, arms and head, sprained arm, shoulder and leg, crushed vertebra and ruptured liver, spleen and kidney.

Astonishingly, he was at it again only a month later: helping to extinguish a small fire, he fell into the flames and suffered second degree burns on legs, belly, chest, lips, left hand and right forearm.

Hemingway's taste for chronic self-immolation was matched by his prodigious feats of drinking: "The manager of the Gritti Palace in Venice tells me," wrote Anthony Burgess later, "that three bottles of Valpolicella first thing in the day were nothing to him, then there were the daquiris, Scotch, tequila, bourbon, vermouthless martinis.

The physical punishment he took from alcohol was ... actively courted; the other punishments were gratuitous – kidney trouble from fishing in chill Spanish waters, a torn, groin muscle from something unspecified when he was visiting Palencia, a finger gashed to the bone in a mishap with a punchbag..."

The drinking got worse after his father shot himself.

Ernest went to a doctor in 1937, complaining of stomach pains; liver damage was diagnosed and he was told to give up alcohol.

He refused. Seven years later, in 1944, when Martha Gellhorn visited him in hospital, she found empty liquor bottles under his bed.

In 1957, his doctor friend AJ Monnier wrote urgently, "My dear Ernie, you must stop drinking alcohol. This is definitely of the utmost importance." But even then, he couldn't stop.

What was bugging Hemingway? Why all the drinking, the macho excess, the manic displays of swaggering? Why was he so drawn to war, shooting, boxing and conflict? Why did he want to kill so many creatures? Was he trying to prove something? Or blot something out of his life?

Some answers were offered in 2006 by a long article in the American Psychiatry magazine, called "Ernest Hemingway: A Psychological Autopsy of a Suicide".

It was by Christopher D Martin, whose official title is Instructor and Staff Psychiatrist at the Menninger Department of Psychiatry and Behavioural Sciences at Baylor College of Medicine in Houston Texas.

Martin had read widely in the 15 or so biographies and memoirs of Hemingway and offered his expert analysis – based, inevitably, at second hand, but still a convincing evaluation.

He had no trouble in diagnosing the author as suffering from "bipolar disorder, alcohol dependence, traumatic brain injury, and probably borderline and narcissistic personality traits".

He notes that many in the Hemingway family – his father and mother, their siblings, his own son and his grand-daughter Margaux – were prone to manic-depression (Margaux's was the fifth, or possibly sixth, suicide in four generations) and suggests that it was Ernest's manic episodes that drove him to his astonishing feats of creativity. But he locates the writer's trauma in two childhood experiences.

It seems that it was his mother Grace's habit to dress him, as a child, in long white frocks and fashion his hair like a little girl's.

It was a 19th-century custom to dress infants alike, but she took it to extremes. She referred to him, in his cute lacy dress, as "Dutch dolly".

She said she was his Sweetie, or, as he pronounced it, "Fweetee". Once, when Ernest was two, Grace called him a doll once too often.

He replied, "I not a Dutch dolly... Bang, I shoot Fweetee".

But she also praised him for being good at hunting in the woods and fishing in the stream in boys' clothes.

It was too confusing for a sensitive kid. He always hated her, and her controlling ways. He always referred to her as "that bitch". He'd spend the rest of his life in a galloping parody of masculinity.

Dutch dolly indeed. He'd show the bitch there was no confusion in his head.

"I shoot Fweetee." The trouble was, he also wanted to shoot his father. Clarence Hemingway was a barrel-chested, six-foot bully, a disciplinarian who beat his son with a razor strop.

Ernest didn't retaliate directly. He bottled it up and subsumed it into a ritual, in which he'd hide in a shed in the family backyard with a loaded shotgun and take aim at his father's head.

Martin speculates that, when Clarence shot himself, Hemingway, aged 29, felt terrible guilt that he'd fantasised about killing him.

Unable to handle this, he took to blaming his mother for his father's death. "I hate her guts and she hates mine," he wrote in 1949. "She forced my father to suicide."

After Clarence's death, Hemingway told a friend, "My life was more or less shot out from under me, and I was drinking much too much entirely through my own fault".

He suffered a chronic identity crisis.

Henceforth he could be warm and generous or ruthless and overbearing. His friendships were often unstable (he could turn vicious or cruel, even with supposedly close pals) and his relations with women were full of conflict. He sulked like a child when, on his first safari, his wife Pauline shot a lion before he did.

And he was pursued, for the rest of his life, by a colossal death wish – either to join his late father, or to expatiate his guilt at his father's death by mirroring it.

Death took up residence at the heart of Hemingway's life, a constant spur to his creative imagination, a constant companion, a dark, secret lover.

Themes of violence and suicide informed his stories from the start.

His letters are full of references to his future suicide.

And when not contemplating his own death, he was putting himself into danger and combat as though to hasten it.

Wars, rebellion, bull-running in Pamplona, big-game hunting in Africa, fishing in Havana – they were all his way of throwing himself before the Grim Reaper. "I spend a hell of a lot of time killing animals and fish," he told Ava Gardner, "so I won't kill myself."

And of course writing was his way of evading the need to die.

He could polish his real-life experiences at war, in Italy, Spain, the Ardennes, and burnish his life in hindsight.

Being awarded the Nobel Prize in 1954 must have been a triumphant affirmation of his genius, but he worried that, after receiving the prize, most laureates never wrote anything worthwhile again.

Luckily, after finding two trunks of notes from the 1920s in a Paris hotel, he was able to manage one more book: A Moveable Feast, his touching memoir of being young, poor and happy in the French capital, with his first wife and baby, before everything started going to hell.

After 1960, however, he found he could no longer write.

The words wouldn't come. Depression came instead, and with it (as we learn from AE Hotchner's memoir, Papa Hemingway), paranoid delusions.

He thought that the two men he saw working late in a bank were "Feds", checking his bank account for irregularities.

He thought his friends were trying to kill him.

When his car slightly grazed another vehicle, he fretted that he'd be thrown in jail. It was a sorry thing, to see the epitome of "grace under pressure" succumbing to dementia.

He was given medication and, horribly, a course of electroconvulsive shock treatments.

In the spring of 1961, he was asked to contribute a single sentence to a presentation volume for John F Kennedy's inauguration.

Hemingway couldn't oblige. "It just won't come any more," he told Hotchner, and wept.

In April, his wife Mary found him sitting with a shotgun and two shells. He was sent to hospital in Ketchum, Idaho, his birthplace, but he tried twice more to end his life, once by walking into the path of a plane taxiing on the runaway.

There was a two-month period of hospitalisation and comparative peace and quiet, when he appeared sane to his doctor and deranged to his wife.

He seemed to be acting, right to the end.

He was released home one more time, had a picnic lunch with wine (he saw some state troopers and was sure they'd arrest him for possess of alcohol) and, the next morning, shot himself.

"The accumulating factors contributing to his burden of illness at the end of his life are staggering," writes Martin, listing Hemingway's bipolar mood disorder, depression, chronic alcoholism, repetitive traumatic brain injuries, the onset of psychosis.

But it seems clear that the defining problem of his life was his experience of childhood.

His confusion over gender, his Oedipal desire to kill his father for beating him, together led to what Martin calls "a retreat into a defensive façade of hyper-masculinity and self-sufficiency".

Building and sustaining the myth of Hemingway the Man's Man took courage and determination, but it was something he needed to do – and when it dwindled, along with the all-important capacity to write, he had no answer except to go the same way as his father.

The image of his father, a moody, bullying, depressive man, but a role model none the less, haunted his life.

He wanted to revivify him, in order to release himself from the responsibility for his death. He wanted to be the big, strong, heroic man that the world could call "Papa".

Fighter, writer, lover: a life in brief

1898 Ernest Hemingway is born in Oak Park, Illinois

1918 Wounded in Italy while working for the Red Cross during the First World War

1921 Marries first wife Hadley Richardson; they move to Paris

1923 First son John is born

1927 Divorced by Hadley, he marries Pauline Pfeiffer

1928 His father Clarence shoots himself in the head

1937 Works as a war correspondent during the Spanish Civil War

1940 For Whom the Bell Tolls is published; Hemingway marries Martha Gellhorn

1944 Reports on the liberation of Paris; begins relationship with Mary Welsh who he will marry in 1946

1952 The novella The Old Man and the Sea is published

1954 Awarded the Nobel Prize for Literature

1961 Shoots himself in the head in Ketchum, Idaho

FUENTE. THE INDEPENDENT
http://www.independent.co.uk/news/people/profiles/being-ernest-john-walsh-unravels-the-mystery-behind-hemingways-suicide-2294619.html?origin=internalSearch

Of mice and medicine: In defence of animal experiments

2011-12-25T18:58:00.000-08:00

Animal experiments in the UK are on the rise.
Though controversial, these tests are transforming human lives, discovers Paul Vallely

Professor David McAlpine, Director of the UCL Ear Institute, where mice are used to investigate tinnitus

A sad-eyed, mournful-mouthed beagle stares out from a poster on a bus shelter by the front door of the Ear Institute of University College London. Below the melancholy dog blares the legend 'Boycott Vivisection'. It is clearly intended to be a reprimand to the scientists passing through the door into one of the world's leading research centres on hearing and deafness.

Not that there are any experiments on dogs going on in the Institute, but then facts are not always the first currency when it comes to the emotive subject of experiments on animals.

The number of research procedures on animals carried out in the UK rose by 3 per cent last year. The figure has risen steadily over the past decade to just over 3.7 million in 2010. 'Procedures' is the term used by the Home Office, which is looking at ways to meet a commitment in the Government's coalition agreement to reduce the use of animals in scientific research. And it is a significant word, for behind it lies a major shift in animal experimentation.

The headline figure disguises considerable changes. Experiments on many of the kind of animals which most inspire protest among animal rights activists were down: dogs by 2 per cent, rabbits by 10 per cent and cats by 32 per cent. Even the eponymous guinea pigs were down 29 per cent. There was also a fall of 11 per cent in the number of animals used in toxicity trials, as thanks to rule changes one test can now be used to satisfy several requirements.

Where there was an increase was in mice and fish – the latter up a whopping 23 per cent. What that reveals is a switch to animals whose genes can be easily modified. An extraordinary 44 per cent of those 'procedures' turn out not to be what most members of the public imagine as an 'animal experiment' but merely the act of breeding transgenic creatures, mostly done by allowing mice to do what male and female mice do naturally anyway. But the nature of the experiments has undergone a notable change.

For decades now, the terms of the debate on this subject have been set by the emotive, sentimental or absolutist intolerance of animal rights activists. We rarely hear the other side of the story, from the scientists who have for years kept themselves in the shadows, for fear of attacks from animal rights extremists, the most violent of whom are now in jail.

Inside the Ear Institute, research is being done by Professor David McAlpine and his colleagues into the problem of tinnitus – that odd buzzing sound in the ears which afflicts most of us when we leave a noisy rock concert. For more than five million people in the UK, however, that noise never goes away.

"People with tinnitus hear a constant noise in their ears, a buzzing, beeping or whining. It can get very distressing," says a senior researcher, Dr Roland Schaette. "Around 10 per cent of the population are chronic sufferers. And for 1 to 2 per cent, their quality of life is badly affected. They lose silence. Some can't relax or sleep. Social isolation and depression can follow. It can drive some people to suicide."

Dr Schaette uses mice in his research, to fill the gap between theoretical models and his experiments on human subjects. "We do behavioural training with the mice," he explains. "Obviously you can't ask them what they are experiencing so you have to train them to behave. We play a loud noise, and they jump. Next we play a low noise before the loud one and they learn not to jump when the big noise comes. Then you induce tinnitus in them and play a low constant noise at the same pitch as the first low noise. Mice with tinnitus don't hear [this] so they jump when the big noise comes; mice without, don't."

What happens then is that Dr Schaette and his research assistant use electro-physiological recording techniques to see how nerve activities are affected. "We place a tiny wire into the brain of a mouse that has been sedated with anaesthetic, and given a pain killer," he says. "Then we can record the reaction of a tiny area of the brain, even down to a single neurone, to see how nerve activities are affected, how it alters and what mechanisms alter it." At the end of the experiment the scientists increase the sedative to a fatal dose so that the mouse dies.

So couldn't they achieve the same ends without using an animal? "There are lots of ways of finding things out," interjects Prof McAlpine. "For some tasks you can use a dish of cells. For others you can used brain imaging like magneto-encephalography", which maps activity by the brain's natural electrical currents by recording the magnetic fields they generate.

"But that is a very limited technique. It is great for telling how the human brain lights up when the body is doing particular activities. But it won't tell you how neural pathways change in tinnitus. You can't tell without an animal model to investigate the neurones. There are more synapses – connections between neurones in the brain – than there are stars in the universe. We can look at which connections grow when a mouse learns a task."

But it is not research like this which accounts for the rise in animal experiments. Across the river at King's College London, in the school of biomedical sciences, research is being done manipulating mice genes in a search for a cure for Parkinson's Disease, the progressive disorder that causes problems with movement, including tremor and muscle rigidity.

This debilitating disease is caused by the death of nerve cells in the brain. It gets worse as more nerve cells die. Doctors don't know why. But through experiments on animals they have discovered drugs which dramatically alleviate the terrible shaking which characterises the disease. The problem is these only work for five years. So further experiments are underway as Roger Morris, Professor of Molecular Neurobiology and Head of the School of Biomedical Sciences at King's College explains.

"The primary cause of Parkinson's is the death of neurons that deliver an essential chemical called dopamine to the forebrain," he says. "The primary treatment is to provide a substitute chemical, L-DOPA. But in the healthy brain, dopamine is released only in very specific regions. L-DOPA, however, penetrates the whole brain, in a way that the body is not used to. Abnormal changes start to happen, resulting in continuous uncontrolled limb and body movements."

Scientists at King's – which has 22,000 experimental animals, 21,000 of them mice – have, over the past couple of decades, used marmosets – small, primitive New World monkeys – to discover the dose of L-DOPA which brings the fewest unwanted side effects. Work with such non-human primates is not quite so controversial as experiments with African monkeys. But this is the kind of work which most incenses animal rights activists.

Professor Morris is unapologetic. "There is a lot you can do without animals. Most scientists who use animals do so as part of a whole portfolio of techniques, which will include work with isolated molecules and genes, building up to whole cells growing on plastic dishes in tissue culture to study the more complex integration of cells to work together as a single tissue," he says. Some 90 per cent of his staff's work is done with individual molecules and cells in culture.

"At all these stages, extensive use is made of computational modelling, and analyses of databases, to bring together all the information available on how the particular aspect we work on functions in a living body," he continues. "And there are now non-invasive brain imaging techniques that tell us a lot. But real diseases are diseases of the whole body, and can only be studied in the whole body."

Dopamine deficiency is a key component of Parkinson's but the underlying cause is a complex set of interactions triggered by inflammation in the autoimmune system. "So we need to understand the interaction between two complex bodily systems – the brain, and the immune system – to understand this multi-tissue, multi-step disease. The body's controls on how those two systems interact are lost the moment both are cultured in a plastic dish. We need to look at living brain."

britain has the strictest rules in the world on such experiments, a House of Lords select committee has found. The Animals (Scientific Procedures) Act 1986 says they can only be performed where there is a clear potential benefit to either people, animals or the environment, and when there is no means of obtaining these benefits without using animals. The act also builds in a cost-benefit analysis which insists, in a very English test of reasonableness, that the good to humans must clearly outweigh the harm to animals.

Experiments must use the minimum number of animals, involve animals with the lowest degree of sensitivity, and cause the least suffering consistent with arriving at a clear scientific conclusion. Institutions, projects and scientists need three sets of licences. Home Office inspectors visit their labs around 12 times a year.

Evidence of proportionality is not hard to find. More than 120,000 people suffer from Parkinson's today in the UK. That seems a grievous problem set against the discomfort of a relatively small colony of marmosets – numbering just a few hundred over the past decade – whose suffering has dramatically improved the treatment of the disease. Moreover, when Parkinson's is induced in marmosets the disease does not progress as it does in human beings "and the animals live into old age, housed in pairs throughout their lives in an enriched environment," Prof Morris says.

All this is a big change from the bad old days. "I was appalled at some of what was allowed when I started my PhD in the United States in 1972," he recalls. "The kind of science done in living experiments with animals has completely changed." Thirty years ago a lot of experiments were with cats and dogs or primates.

Today there are more experiments recorded, but the animals used are mostly mice and fish and the procedures are considerably less severe. Before 1984, scientists could do anything with an animal that the Home Office had not specifically disallowed. Today the default is reversed; nothing is allowed that has not been specifically sanctioned.

In the old days the first line of experiment was often with the living animal, and the tests used were not very sophisticated. Now, before they get to an animal, scientists have refined the question they want to ask by extensive work with cells and computer modelling.

Previously, scientists had to breed a large number of animals just to get the type they needed – mice of the same age with the same parents. Now, thanks to genetic modification, they can generate precisely the number and kind they need for a particular experiment.

"We increase the number of animals used," says Professor Dominic Wells, of the neuromuscular disease group at the Royal Veterinary College, "but we decrease the overall severity of what we're doing." The technology allows a gene to be deleted so that an adult mouse appears to be normal until asked to remember something, which it cannot then do.

A scientist working elsewhere on spinal cord injuries, who asked to remain unnamed for fear of animal rights reprisals, elaborated on this. He is working on trying to stimulate the human body to regenerate nerves in the spinal cords of the 400,000 people in Europe who are paralysed after back or neck injuries from car accidents, violent falls or sports injuries.

"Human suffering is far more protracted and severe than anything we would allow in animals," he told me. "Procedures are done to reduce discomfort to a minimum. Our work is about understanding the early stages of the development of diseases, before irreversible brain damage has commenced, and understanding the subsequent disease mechanism so we can prevent it at an early stage. So we don't need to take animals to extremes. We can study the effects of that in humans."

What that means in practice is that, in his case, rats are partially paralysed – in one paw or to impair the tail. "You wouldn't enter a rat with a partial lesion of its spinal cord in a rat race," he told me, "but it can get around the cage well enough. What we are studying is mechanisms, so a 10 per cent paralysis will suffice to study what prevents a paraplegic human from recovering – and being condemned to 30 years in a wheelchair." Researchers have already discovered an enzyme which allows previously disabled rats to walk again almost normally.

There are both scientific and moral reasons that impel scientists to choose the simplest animal system that will give them the result they seek. "We do have a moral perspective about an animal's suffering," says David McAlpine. "There is a hierarchy. I'm unashamedly modernist about that. You take the animal that's the lowest in the hierarchy that will answer your question."

So basic studies on cell-division could be done to Nobel Prize level, as they were by Sir Paul Nurse, studying something as primitive as yeast, Prof Morris says. "It's very fast, very simple and you get clear answers quickly. But as you ask more detailed or complicated questions you need to go up the chain – to fish, mice, rats, bigger mammals and sometimes primates."

Prof McAlpine concurs. "Fruit flies go deaf for the same reasons you and I do," he says. "So you can do some basic work with them and do it much more quickly because they have simpler nervous systems. A mouse has a different hearing range from a human – it hears much higher sounds – but mice are close enough to us for use to study the range of hearing loss problems we have. For some things people use guinea pigs because they have a very similar hearing range to humans; you can do a cochlear implant in a guinea pig but not in mouse.

Despite the focus on dogs, cats and monkeys in the campaign posters of animal rights activists, those creatures were used in less than half of 1 per cent of all procedures in last year's official figures. A report by Professor Sir Patrick Bateson, president of the Zoological Society, in July found that 91 per cent of research on non-human primates between 1997 and 2007 was of high quality and scientifically and ethically justified. It is being conducted by 72 researchers working mainly on Alzheimer's and Parkinson's. Some animals were used in more than one procedure since the experiments had only minimal effect on the animals. Since then, The National Centre for the Replacement, Refinement and Reduction of Animals in Research has been brought into tighten up conditions to avoid even that 9 per cent failure rate. They vet each application for experiments involving primates.

But monkeys are not the area of innovative work in animal research. Fish are. Or to be more precise, zebrafish. In the Randall Division of Cell and Molecular Biophysics at King's College in London, Dr Claudia Linker is at her computer looking at a video made through a microscope of a small tear made in the tail of a zebrafish.

Zebrafish are those tiny, iridescent, black-striped creatures, originally natives of the Ganges River in India but popular now in Britain's home aquariums. But they are perfect creatures for the study of the early development of embryos. Not only do they grow up and reproduce in just three months, going through the same development stages as a human embryo, but their tiny eggs have clear shells that develop rapidly into translucent embryos so they can be studied using just an optical microscope.

They are easy to keep in a laboratory, lay around 200 eggs at a time which can be harvested without the need to kill the mother (as happens with lab mice). They develop from egg to fish within 18 hours. Scientists can not only look at a fish's heart beating under a microscope, they can mark individual cells with a fluorescent marker gene which they transfer from jellyfish. They can use different coloured markers for different cells and watch different cells participating in the embryo's development and multi-tag all the tissues. And their genes can be modified more easily than those of mice.

Dr Linker is enthralled by what she can see. The movement of blood cells towards the wound is clearly evident. "Can you see them moving?" she asks and shows me different examples of migratory cells. "My work is to find out how cells know when to start migrating, where to go, what to do when they arrive at their destination. I am not working on curing a particular disease but on understanding how the basic mechanism directing cell migration works. Once we understand it we might learn how to intervene to promote cells to do what we want, for example, stop the migration of cancer cells. It's very exciting, but it is open-ended."

Down the corridor, her colleague Professor Simon Hughes is doing something similar on skeletal muscle development. "We need to understand what is the signal mechanism within an embryo that says make a muscle here, a heart there, a liver over there – and you can't find that out from a test-tube."

Research on zebrafish published earlier in the year found that the fish are able to repair muscle within their hearts. "That's not something that happens in us, or mice. By experimenting with that it may well be possible to gain some insight that will enable human hearts to be regenerated," says Prof Hughes, who once researched with mice but switched to zebrafish. He is attempting to lay the groundwork for treatments for muscular dystrophy.

Wandering through a laboratory like this can be an exciting journey. By the stairs I meet Dr QueeLim Ch'ng who decided to study C elegans, a little worm almost too small to see with the naked eye, and discovered proteins which turn out to be involved in premature ageing, and which in man are critically involved in Alzheimer's.

Another King's scientist has discovered that coral produces a chemical which enables it to adapt to living in UV light – and that fish which eat the coral transfer that chemical to their eyes, so they don't get UV damage from light. The next step will be to see how the chemical moves from the fish's digestive system into its eyes by implanting the chemical in mice; the hope is that the research will lead to a treatment to prevent macular degeneration, which causes blindness in humans.

In another lab, a PhD student has identified the world's first therapy to partially reverse arm disabilities in strokes – and he did it by injecting a human molecule which naturally occurs in muscle into the upper arm muscles of rats. It even works 24 hours after a stroke.

Several of the range of drugs which have changed the lives of people with Aids have been based on animal experiments studying the mechanism of which cells it infects, how it gets into those cells, why it binds to particular receptors, and which drugs block that interaction. "Now," says Professor Morris, "we are working on something similar with Alzheimer's, trying to make a mouse model by altering three mouse genes to reproduce in mice some of the behaviour found in people with Alzheimer's."

For a nation of pet-lovers, we Britons take a surprisingly pragmatic attitude to all this. Most of us are aware of the ambiguity of our relationship with animals. Over 90 per cent of the population eats meat. As we are happy to breed animals for food, so we are content, too, to see them bred for experiments which improve human health. Polls consistently show that 60 per cent of the population are happy for any experiments to be done on animals. The proportion of Brits who accept animal experiments, subject to the kind of conditions now in place, is over 90 per cent. When you spend a little time with the scientists involved, you understand why.

fuente: http://www.independent.co.uk/news/science/

Language Impairment Associated With Arachnoid Cysts: Recovery After Surgical Treatment

2011-12-25T18:25:00.000-08:00

Case Report

Image: radpod.org

Authors
Nicole Laporte BSca, Anne De Volder MD, PhDa, Christine Bonnier MD, PhDa, Christian Raftopoulos MD, PhDb, Guillaume Sébire MD, PhDc, Corresponding Author Contact Information, E-mail The Corresponding Author

a Service de Neuropédiatrie, Cliniques Universitaires Saint Luc, Université Catholique de Louvain, Brussels, Belgium
b Service de Neurochirurgie, Cliniques Universitaires Saint Luc, Université Catholique de Louvain, Brussels, Belgium
c Service de Neurologie Pédiatrique, Centre Hospitalier Universitaire de Sherbrooke, Faculté de Médecine, Université de Sherbrooke, Sherbrooke, Quebec, Canada

Available online 22 December 2011.
Abstract

Supporting data from the literature, we observe that large arachnoid cysts may affect cognitive function.

Neuropsychologic assessment plus magnetic resonance imaging allowed for documentation of associations between left temporal arachnoid cysts, language impairment, and other cognitive dysfunctions.

Significant cognitive improvements were evident soon after cysto-peritoneal shunting.

These observations reinforce the rationale for neuropsychologic assessments of patients with developmental delay and arachnoid cysts, and support the potential benefit of surgical decompression for arachnoid cysts associated with neurologic deficits, even if surgery is performed well after the occurrence of neurologic deficits.

Corresponding Author Contact InformationCommunications should be addressed to: Dr. Sébire; Service de Neurologie Pédiatrique; Centre Hospitalier Universitaire de Sherbrooke; Faculté de Médecine; Université de Sherbrooke; 3001 12ème Avenue Nord; Sherbrooke, Quebec J1H5N4, Canada.

FUENTE: Pediatric Neurology
Volume 46, Issue 1, January 2012, Pages 44-47
doi:10.1016/j.pediatrneurol.2011.10.001

EL USO DE PIROTECNIA PUEDE PROVOCAR DAÑO EN LOS OIDOS

2011-12-25T18:15:00.000-08:00

22 de diciembre de 2011 • 11:15

El uso incorrecto de los artefactos de pirotecnia que se utilizan en la actualidad puede provocar traumas acústicos que derivan en pérdida auditiva permanente e irreversible, explicaron especialistas de la comisión de Ecología del Colegio de Fonoaudiólogos de la regional La Plata.

La pirotecnia en general, que se vende en el mercado produce sonidos de muy alta intensidad que al explotar pueden llegar hasta los 120 ó 140 decibeles, equivalente al producido por un arma de fuego o despegue de avión", explicó la entidad.

Los expertos señalaron que "está científicamente comprobado que toda intensidad sonora que supere los 90 decibeles resulta dañina para el oído.

De acuerdo con las últimas estadísticas oficiales, correspondientes a la atención de pacientes en la última Navidad, casi el 20% de los accidentados que ingresaron a las guardias presentaban alguna lesión auditiva.

De los 85 jóvenes y adultos atendidos en esa fecha, 15 tuvieron que recibir, además, atención en los servicios de audiología.

La secretaria del Colegio de Fonoaudiólogos, Noemí Díaz, explicó que al estallar un petardo por ejemplo, se produce un ruido corto, muy intenso e imprevisto, por lo tanto el oído de quien está cerca o lo manipula, pierde su capacidad de defensa".

"De esta manera es que puede producirse un `trauma acústico´ lo que provoca una pérdida auditiva permanente e irreversible y también resultan frecuentes las apariciones de zumbidos, en los momentos posteriores a la detonación", advirtió.

Díaz remarcó que "la pérdida súbita de la audición es una verdadera urgencia otorrinolaringológica que debe tratarse sin la menor dilación, en menos de 24 horas si es posible, para tener las mayores posibilidades de recuperación".

A partir de los resultados de estos estudios, el Colegio de Fonoaudiólogos de La Plata recomendó una manipulación responsable de este tipo de artefactos.

La presidenta del Colegio de Fonoaudiólogos de La Plata, Alejandra Morchón, expresó que "en esta época del año se intensifica el uso de pirotecnia y a veces los adultos no asumen los recaudos necesarios".

"Promovemos el uso responsable para preservar la salud de la población, aseguró.

Díaz explicó que los primeros síntomas de una afección en el aparato auditivo son el aturdimiento, molestia auditiva y en ocasiones, pérdida de equilibrio y zumbidos agudos.

Las autoridades explicaron que el riesgo es mayor aún si la explosión ocurre en lugares cerrados, como puede ser un balcón, un patio cubierto, un galpón ya que el sonido reverbera.

"Estamos hablando de que en algunos casos se duplica el ruido que se acepta como tolerable para un ser humano" dijeron los especialistas.

Silvia Bermúdez, responsable de la Comisión de Ecología del Colegio, explicó que "el oído está provisto en forma natural de un mecanismo protector que reduce la transmisión de los sonidos más intensos hacia las delicadas células del oído interno, pero actúa recién después de unos diez centésimos de segundo, por lo cual es ineficaz frente al ruido de los petardos".

"En general las personas asisten a consulta de guardias médicas, por otro tipo de consecuencias como quemaduras o heridas en ojos, y recién advierten el daño auditivo posteriormente, aseguró Díaz.

fuente: http://noticias.terra.com.ar

¿CUANTO TIEMPO DURAN LOS AUDÍFONOS?

2011-12-25T18:02:00.000-08:00

¿Cuánto tiempo duran los audífonos ?

fuente de la imagen: timothybaril.com

Martes, 20 de diciembre 2011

Los audífonos normalmente duran de tres a cinco años, aunque en algunos casos pueden durar mucho más.

Los componentes en miniatura en los audífonos tienden a desgastarse con el tiempo, e incluso cuando son reparados, no tienen la misma integridad que los nuevos componentes.

Aunque los audífonos son frágiles aparatos electrónicos en miniatura, que están expuestos a la humedad, la transpiración,la cera de los oídos ya veces la lluvia, o la laca y otros factores - que no son ideales para los dispositivos médicos minúsculos.

Se ha demostrado que el uso de deshumidificadores especiales de audífonos , que ayudan a eliminar la humedad de los audífonos cuando no se utilizan, prolonga la vida de los audífonos.

Estos dispositivos pueden ser obtenidos a partir en su centro de ventade audífonos local . Además, la limpieza de sus audífonos con regularidad le ayudará a asegurarse que tengan una larga vida.

En muchos casos, la pérdida de la audición tiende a empeorar con el tiempo.

Por lo tanto, puede ser necesario usar audífonos nuevos para adaptarse a su pérdida de audición a medida que cambia.

Mientras que en muchos casos, los audifonos digitales modernos puede ser re-programados,para adaptarlos a cambios en la audición, algunas personas optan por comprar audífonos nuevos con el fin de beneficiarse de nuevas características que vienen con los avances en la tecnología de los audífonos.

FUENTE: http://www.healthyhearing.com

Chronic intracranial hypotension.General Information

2011-12-24T10:33:00.000-08:00

Intracranial Hypotension

Intracranial hypotension is a condition in which there is negative pressure within the brain cavity.
There are several possible causes:
Cerebrospinal fluid (CSF) leak from the spinal canal:
A leak following a lumbar puncture (spinal tap).
A defect in the dura (the covering the spinal tube).
Spontaneous, sometimes following exertion such as swinging a golf club.
A congenital weakness.
Following spinal surgery.
Following spinal trauma.
Following a shunt procedure for hydrocephalus.
Lumboperitoneal shunt.
Ventriculoperitoneal shunt with a low pressure valve.
In some cases, spinal CSF leaks can lead to a descent of the cerebellar tonsils into the spinal canal, similar to a Chiari malformation.
Large spinal dural defects can lead to herniation of the spinal cord into the defect.

Symptoms

The classic symptom is severe headache when upright, which is relieved when lying flat.
Other symptoms can include nausea, vomiting, double vision and difficulty with concentration.

Diagnosis

Diagnosis is usually suspected based on the postural dependency of the headache, although in many cases the diagnosis of intracranial hypotension is not considered for some time.
A contrast-enhanced brain magnetic response imaging (MRI) scan typically shows thickened and brightly enhancing meninges (pachymeningeal enhancement). Other findings include descent of the thalamus and cerebellar tonsils.
Continuous intracranial pressure monitoring is definitive for documenting abnormally negative intracranial pressures.
The identification of the site of CSF leak in the spinal canal can be very challenging. In some cases, the site cannot be identified. Methods include:
Dynamic myelography with fluoroscopy and computed tomography (CT).
Radioisotope cisternography.
Spinal MRI.

Treatment

If the site of the spinal CSF leak can be identified, then options include:
Epidural blood patch, performed by an anesthesiologist pain management specialist.
Surgical repair of the defect.
Over-draining CSF shunts are managed by replacing the valve with one that drains less.
Lumboperitoneal shunts may have to be removed or ligated.

Outcome

If the cause of the intracranial hypotension can be identified, the outcome following treatment is typically excellent.

fuente: UCLA
http://neurosurgery.ucla.edu/body.cfm?id=1123&ref=55&action=detail

Chronic intracranial hypotension.

2011-12-24T10:29:00.000-08:00

Mackenzie RA, Lethlean AK, Shnier R, Blum PW

Acute intracranial hypotension can occur following lumbar puncture or a fall, and sometimes spontaneously.

Most cases resolve within weeks or months but some require surgical repair of the defect causing leakage of cerebrospinal fluid (CSF).

It is conceivable that such leaks could become chronic if the defect is incompletely sealed.

We report the case of a 49-year-old male who presented with a 10-month history of headache associated with a leaking thoracic extradural arachnoid cyst.

After this was repaired he reported relief not only of his recent headaches but also of chronic alcohol-related headaches.

A long-standing anaemia resolved and tinnitus hyperacusis improved.

It is suggested that an injury 30 years before may have initiated the leak of CSF resulting in chronic intracranial hypotension.

Fuente: J Clin Neurosci 1998 Oct; 5(4):457-60.

Alteraciones otorrinolaringológicas en el anciano

2011-12-24T08:52:00.000-08:00

Aunque la afección más popular es la presbiacusia, debido a las alteraciones psicológicas y sociales que origina, el anciano puede presentar las mismas enfermedades del adulto, incluso algunas con mucha mayor frecuencia
En todo caso, estas enfermedades presentan en la persona mayor unas características especiales que hay que tener en cuenta a la hora de valorar al paciente

La sordera tiene un efecto adverso sobre las funciones cognitivas, conducta emocional y bienestar social, y puede ser un factor con peso específico considerable
para llevar una vida independiente.

Prevalencia
Cerca de un 25% de las personas de 65-74 años y hasta el 50% de los mayores de 75 años sufren una pérdida de audición.

Valoración de la discapacidad auditiva del anciano

Prueba de la voz susurrada

Se explica al paciente que se le pedirá que repita tres números. El examinador se coloca detrás del paciente para evitar que le lea los labios.
Se tapa el oído contralateral. A continuación el examinador espira completamente (lo que reduce el volumen de la voz) y, desde una distancia de unos 60 centímetros
de la oreja, le susurra tres números.
Si el paciente no puede repetir el 50% (tres números o más) en dos ensayos,
se considera que no ha superado la prueba.

Clasificación de la patología

Oído externo
1. Tapón de cerumen.
2. Otitis externa.
3. Otitis externa maligna.
4. Tumores benignos.
5. Lesiones precancerosas.
6. Tumores malignos.

Oído medio
1. Otosclerosis.
2. Otitis media aguda.
3. Otitis media crónica.
4. Tumores.

Oído interno
1. Presbiacusia.
2. Acúfenos.

Faringe
1. Faringitis crónica.

Oído externo

Tapón de cerumen
Motivo de consulta. Paciente que refiere hipoacusia (de transmisión) y/o inestabilidad y mareos, así como sensación de ocupación y autofonía.
Exploración y diagnóstico. Por otoscopia se visualizará el tapón de cerumen obstruyendo el conducto auditivo externo (CAE).
Actitud terapéutica. Extracción:
1. Reblandecimiento del tapón mediante gotas
tópicas disolventes.
2. Extracción con agua templada mediante jeringa
apropiada.
3. Nunca usar pinzas para su extracción.
Complicaciones de la extracción: breve crisis vertiginosa
por la introducción de agua muy caliente o fría.

Perforación timpánica
Motivo de consulta. Paciente que consulta por hipoacusia (de transmisión), otalgia, drenaje por el oído y acúfenos.
Entre sus antecedentes personales destaca otitis media o traumatismo mecánico o barotrauma.
Exploración y diagnóstico. En otoscopia se visualiza la perforación timpánica.
Actitud terapéutica. El tímpano roto o perforado tiende a recuperarse por sí solo en dos meses. Los objetivos del tratamiento son aliviar el dolor y prevenir
la infección.
La reparación quirúrgica está indicada cuando:
— Hipoacusia de conducción significativa.
— Infección crónica y otorrea.
— Presenta riesgo de aparición de colesteatoma.

La edad avanzada no es una contraindicación para la reparación en un paciente que esté por lo demás sano.

Otitis externa

Motivo de consulta. Paciente que consulta por OTALGIA (al presionar el trago), hipoacusia (de transmisión) y en ocasiones prurito (cuando la etiología es
otomicosis).
Exploración y diagnóstico. En la otoscopia se aprecia el oído enrojecido e inflamado, incluyendo el canal auditivo, el cual puede aparecer similar a un eccema
con descamación de la piel.
La palpación o manipulación del oído externo aumenta el dolor. El cultivo del drenaje del oído puede revelar la presencia de bacterias u hongos.
Tratamiento. Generalmente, la aplicación tópica de gotas que contienen antibióticos para combatir lainfección y corticoides para reducir el prurito y la inflamación
es efectiva. Ocasionalmente, los medicamentos tópicos se complementan con pastillas.
En casos en que el dolor sea muy severo, se pueden usar analgésicos, y también resulta útil la aplicación de calor sobre el área afectada para reducir dicho dolor.

Otitis externa maligna o necrotizante
Motivo de consulta. Anciano diabético o inmunodeprimido que consulta por otitis externa pertinaz y progresiva.

El cuadro se puede acompañar de focalidad neurológica (parálisis facial periférica).
Diagnóstico. El cuadro es producido por pseudomona aeruginosa.
En la otoscopia llama la atención la presencia de tejido de granulación con formación de pólipos y esfacelos en las paredes del conducto. Posteriormente
necrosis de tejidos adyacentes.

Realización de tac craneal.
Tratamiento. Es un cuadro poco frecuente, pero muy grave (mortalidad 50%).
Tratamiento con ciprofloxacino 400 mg/12 h iv o ceftacidima iv 2 g/8 h.
Cuidados locales con desbridamiento quirúrgico.

Tumores benignos

Queratosis seborreica
Motivo de consulta. Consulta por lesión elevada, irregular, untuosa al tacto, con formación de quistes y surcos que pueden sangrar.
Tratamiento. Extirpación quirúrgica.

Lesiones precancerosas

Cuerno cutáneo

Motivo de consulta. El paciente consulta por neoformación verrugosa claramente delimitada de la epidermis con superficie ligeramente rugosa, que, localizada en el pabellón auricular, no afecta al cartílago.
Tratamiento. Extirpación quirúrgica.

Queratosis senil
Motivo de consulta. Aparición de elevación de la piel sobre el pabellón auricular y el conducto auditivo externo mal delimitada y superficie áspera, intacta y
parcialmente cubierta con costras que no infiltra el cartílago. Carecen de fositas y surcos característicos de la queratosis seborreica.
Es la lesión precancerosa más frecuente en el anciano.
Tratamiento. Extirpación quirúrgica.

Tumores malignos

Carcinoma espinocelular

Motivo de consulta. El paciente presenta tumor exofítico mal delimitado, superficie ulcerada, localizado en el borde del pabellón, infiltra el cartílago. Crece lentamente y produce metástasis en ganglios linfáticos.

Tratamiento. Extirpación quirúrgica amplia y vaciamiento cervical ganglionar si hay extensión regional.

Pronóstico. Lesiones pequeñas del hélix o antehélix tienen una tasa de curación a los cinco años del 95%, mientras que las lesiones próximas al meato auditivo
tienen peor pronóstico.

Oído medio
Otitis media aguda

Motivo de consulta. El paciente presenta hipoacusia,
autofonía, acúfenos y otalgia.
Diagnóstico. Otoscopia: tímpano hundido y/o congestivo.
Ante todo anciano que presenta una otitis aguda o serosa, especialmente si es unilateral, se debe explorar el cavum para descartar patología tumoral.
Tratamiento. Tratamiento de la infección si existe.

Otitis media crónica

Motivo de consulta. Se caracteriza por la aparición de procesos infecciosos que se prolongan durante más de seis semanas o bien cuando los episodios se
presentan tres o más veces al año. Ausencia de dolor e hipoacusia.
Diagnóstico. Otoscopia: perforación del tímpano y supuración fétida.
Cultivo del exudado.
Tratamiento. Antibioterapia y plantear cirugía.

Oído interno

Presbiacusia
Motivo de consulta. El paciente presenta hipoacusia de percepción pura (3), es decir, no hay separación entre la conducción ósea y aérea. Es bilateral y
aproximadamente simétrica.
Comienzo insidioso, nunca bruscamente; precozmente aparecen dificultades para la audición de sonidos agudos (timbre del teléfono, pájaros...).
Alteraciones de discriminación en ambientes ruidosos o en conversaciones cruzadas. Oyen pero no entienden.

Diagnóstico. Audiometría tonal y verbal:
La curva total desciende gradualmente y bilateral de las frecuencias agudas con conservación de las graves.
Hay discordancia entre la inteligibilidad, la discriminación y la curva tonal.
Tratamiento. Médico: carece de terapia eficaz.
Refuerzo psicológico o pautas de comunicación:

1. Mire de frente a la persona que tiene pérdida de audición para que ella pueda ver su cara cuando usted hable. Esto le permite a una persona con deficiencia de la capacidad auditiva observar las expresiones faciales, los gestos y movimientos
corporales y de labios, todas claves que facilitan la comunicación.
2. Hable lentamente y pronunciando.
3. Durante las conversaciones, apague la radio o televisión. Ambiente silencioso.
4. Hable levemente más fuerte que lo normal, pero no grite. El grito puede distorsionar su habla.
5. Reformule las afirmaciones con oraciones más cortas y sencillas si cree que no están entendiendo lo que dice.
Rehabilitador: prótesis acústica.
Una persona con hipoacusia bilateral debería usar audífonos bilaterales, ya que permiten mejorar la discriminación, la localización del sonido y percibir mejor
las conversaciones en lugares con ruido. Sin embargo, muchas personas no pueden permitirse comprar dos aparatos. El coste normal de un audífono es de
1.000-2.500 euros.
Si la única opción es colocar un audífono, debe colocarse en el que tenga menor hipoacusia.

Acúfenos

Motivo de consulta. Los acúfenos, tinnitus o ruidos de oído, tan frecuentes en el anciano, representan uno de los problemas más difíciles de resolver.
Tratamiento. Pueden mejorar con medicación vasorreguladora.

Patología vestibular
Motivo de consulta. Cualquier alteración de estas estructuras origina un desequilibrio que se va a expresar en forma de crisis vertiginosa (sensación errónea
de giro de objetos), desequilibrio (pérdida del balance corporal en la bipedestación), mareo (sensaciones vagas o inespecíficas o vista nublada).
Muchos procesos pueden producir este cuadro.

Enfermedad de Meniére

Motivo de consulta. Crisis vertiginosas intensas,
cortejo vegetativo, hipoacusia brusca, acúfenos.
Sensación de plenitud auricular. Intercrisis libres de síntomas.

Tratamiento. Restricción de sal y el uso de diuréticos El uso episódico de antivertiginosos es útil para el tratamiento de los episodios de vértigos.

Faringe
Faringitis seca
Motivo de consulta. El paciente con procesos urémicos, diabéticos, con falta de hidratación o en fase terminal que presenta: sensación de sequedad, picazón, carraspeo y/o sensación de cuerpo extraño en faringe.
Diagnóstico. Mucosa atrófica, seca, brillante.
Secreciones costrosas.
Tratamiento. Hidratación e intensa humidificación.
Vitaminoterapia

Fuente: parte del articulo
DEPRIVACIÓN SENSORIAL
Isabel Ródenas Iruela
Mercedes García Moreno
Javier Bordas Guijarro
M.ª Ángeles Flores Carmona
Carlos Martínez Manzanares

Better Ways to Wire Your Ears for Music

2011-12-24T08:27:00.000-08:00

By SAM GROBART
Published: December 21, 2011

Dollar for dollar, headphones are the best way to listen to music. They pack more sonic wallop than even the most face-meltingly amazing loudspeaker system, and they do it for a lot less money. Think about it: a truly magnificent home-speaker system can cost well into the tens of thousands of dollars. A screaming set of headphones? A few hundred bucks, tops — and those in the Really Quite Good category can cost less than $100.

The basic Apple earbuds are among a selection of listening options that range from simple to sophisticated.
Tony Cenicola/The New York Times

The AKG K 390 noise-canceling headphones.

And yet most people go along and listen to music on whatever headphones or earbuds came with their audio player. For not a lot of money (or, if you’d prefer, kind of a lot of money) you can make a real and lasting improvement to the music you hear when you’re on your own. What follows is not an exhaustive test of headphones, because what sounds good to one person may be just plain terrible to another. Instead, use the information below to find your own sonic bliss.

THE GOOD BRANDS There are dozens of headphone makers. If you’re beginning a search, consider models from these manufacturers: AKG, Audio-Technica, Beyerdynamic, Etymotic, Grado, Klipsch and Sennheiser. Are there other makers of good headphones? Sure, but even though furious debates rage on in audiophile circles, these are the names that keep coming up. As to which brand is best, it depends on your needs.

REGARDING BEATS BY DR. DRE It seems necessary to mention here why Beats by Dr. Dre, a popular and groundbreaking headphone brand, is not included in the above group. Some people love Beats, which are known for their (overly?) strong bass. Some people think they are overpriced and not that good. There’s too much disagreement out there to include them in the “universally liked/respected” camp. They sure do look nice, though, so by all means check out the shiny red or white Beats models and come to your own conclusion.

KNOW YOUR HEADPHONE TYPES “Earbuds” are those earphones that likely came with your phone or music player. Replacement pairs can be bought for as little as $5 and often top out at around $30. Earbuds sit somewhat in your ear, but not all the way in. They are usually a single piece of plastic. maybe with some softer rubber permanently attached. These are the coach class of headphones; they’ll get you there, but nobody raves about them.

“In-ear earphones” are a step up. These models consist of a hard part, which contains the mechanics and electronics, and a very soft, pliable earpiece that goes well into your ear, plugging up the canal and forming a seal. In-ear earphones can be amazing — and also costly. For example, some models, like Klipsch’s Lou Reed X10i Signature Edition headphones, cost $400. But other well-regarded models, like Klipsch’s comparatively downmarket headphones, the S3s, cost $50.

Just remember two things about in-ear earphones. They do form a nearly soundproof seal, so you won’t hear much, like, say, a fire truck rapidly approaching a crosswalk, and that seal is entirely dependent on little rubber or polyurethane earpieces, which have an annoying tendency to pop off and roll down a storm drain when you pull the earphones out of your pocket.

“On-the-ear” headphones start to get you into more serious territory. These models don’t fully enclose the ear, but sit on top of the outer ear; if you think of foam-covered, Walkman-era headphones, you’ve got a correct, if outdated, image in mind.

On-the-ear headphones strike a middle ground between superportable in-ear models and bulkier over-the-ear headphones. Since they neither plug up your ear canal nor encapsulate your entire ear, they do let external sounds creep in, but in a home setting or even in many portable situations, you may not want to be fully closed off from the world around you. Prices run from $50 to $200.

On-ear headphones can either have an open or closed back. Open-backed headphones allow air to circulate, which is more comfortable. They also can help give the impression that sound is coming from around you, as opposed to emanating from your corpus callosum, which is a characteristic of closed-back and in-ear headphones. Closed-back models are better at sealing off the outside world, but your ears may get hot from the lack of air circulation.

“Over-the-ear” headphones are the Nimitz-class of the category. These are large domes that fully sit around and over your ear. They are bulky, often expensive (you can spend $40, or nearly $2,000), hard to travel with, primarily meant for listening at home and — when they are good — completely amazing. Over-the-ear models can also be closed- or open-backed. Since they are generally designed for home use, they sometimes come with a larger plug (0.25 inches, or 6.35 mm) instead of the miniplug (3.5 mm) connections common to digital music players.

The Beyerdynamic T-1 headphones.

The AKG K 450 headphones.

UNDERSTAND NOISE CANCELING A subcategory of headphones provides noise-canceling (N.C.) features. Noise-canceling headphones can be active or passive, but wearing them won’t turn the world into a silent movie: some noise will get through. What will be eliminated is lower-frequency ambient noise, like the constant thrum in an airplane’s cabin. This means you can listen to your selected audio at a lower volume, saving your ears.

Passive noise cancellation isn’t very sophisticated — sealing off your ear canal or covering your whole ear are the most common methods — but it is fairly effective. What’s fancier is active N.C., in which the headphones detect ambient noise and emit a sound wave that cancels out the humming/buzzing you would otherwise hear.

Noise-canceling headphones are good for certain situations, but they aren’t necessary for everyday use and most people can do without them. They can also run from about $70 to a few hundred dollars. Bose is a big name in the active-N.C. world, but also consider the brands mentioned above, many of which offer active N.C. headphones in earbud, on-the-ear and over-the-ear models.

FIND YOUR PAIR (THE RIGHT WAY) Determining which kind of headphones to get is something only you can figure out. Some people, for example, prefer the portability that a pair of earbuds provide — just roll them up and stick them in your pocket. Other people can’t stand the idea of little rubber plugs sticking in their ears.

You won’t know your own preference until you try headphones out in person. Go to a store and try out a few different models. Bring your iPhone, iPod, Zune, whatever, and connect it to a pair and play a song you know really well. It may be more revealing if you’re listening to some obsessively engineered track that creates an unparalleled soundscape (I’m talking to you, Steely Dan fans), but even if your favorite song is “Jump” by Kriss Kross, it’s better to judge equipment with a song you know than something provided by the store.

Using your reference song, you can then determine which style and model of headphone sounds best. Pay no attention to the specs. It doesn’t matter what it says on the side of the box; if it sounds good to you, then it sounds good.

Fuente: The New York times, Personal Tech.
http://www.nytimes.com/2011/12/22/technology/personaltech/do-some-research-to-improve-the-music-to-your-ears.html?pagewanted=1&sq=ear%20sounds&st=cse&scp=1

Who Made That Sound?

2011-12-24T08:00:00.000-08:00

By HILARY GREENBAUM

For the past week, I actually haven’t set foot on the sixth floor, as I’ve been serving my civic duty as a juror in the State of New York. Between each case that’s called, though, I can’t help hearing that sound. If you’ve ever watched an episode of “Law and Order,” you know exactly what I mean. It has been called, among other variations, the “doink doink,” the “dun dun” and the “chung chung.”

No, the courts of New York do not actually blast those two, distinctive notes through the speaker system (although that would be amazing), but I can’t get them out of my head. According to IMDb, “The distinctive thunk-thunk sound effect used in between scenes was created by combining close to a dozen sounds, including that of a group of monks stamping on a floor. The sound is intended to be reminiscent of both a jurist’s gavel and a jail-cell door slamming.” When the original “Law and Order” was canceled last year, Brandon Kim of I.F.C. referred it as the “sound that’s got to be the current title holder for Most Recognizable Sound on TV.”

That audible brand was created by Mike Post, who also wrote the theme to the show. He’s a Grammy and Emmy award-winning composer who has scored the themes of television shows like “The A-Team,” “Doogie Howser, M.D.,” “MacGyver,” “Magnum, P.I.,” “N.Y.P.D. Blue” and “The Greatest American Hero.” Multiple albums are available of Post’s work, including “Inventions from the Blue Line” and “The Essential Mike Post TV Theme Collection.”

Fuente: The New York times
http://6thfloor.blogs.nytimes.com/2011/03/28/who-made-that-sound/?scp=4&sq=head%20sounds&st=cse

To Sleep on the Subway, Maybe, but to Dream? Poor Chance

2011-12-24T07:53:00.000-08:00

Dr. Brandon Foreman, a neurology fellow, was able to fall asleep on the A train to help a researcher study the quality of sleep obtained on the subway.
image: Marcus Yam for The New York Times

By CHRISTINE HAUGHNEY
Published: December 7, 2011

A ride on the New York subway can be a sensory overload: musicians perform for change; conductors plead to those who hold open train doors to relent; and passengers, often in unimaginably close proximity, subject one another to all sorts of sights, sounds, smells and touches, preferably inadvertent.

Milagro Benitez wired Dr. Foreman's head with electrodes to capture brain-wave data while he slept. He was asleep for 10 minutes on a 23.5-minute ride.

Amid all of that, some New Yorkers nevertheless manage to fall asleep. Seats are found, trains begin their rhythmic rattles of movement, and eyelids flutter closed. Gritted jaws loosen, furrowed brows release and heads nod.

People outside of New York may wonder how in a city that never sleeps, so many New Yorkers manage to doze on the subway.

There is no law against it, but those who take subway catnaps do so at their own risk; a recent Metropolitan Transportation Authority committee meeting featured a presentation on how criminals seeking iPhones slice open the pockets of dozing passengers.

So are these naps really worth the trouble?

Dr. Carl Bazil, director of the Epilepsy and Sleep Division at New York-Presbyterian Hospital/Columbia University Medical Center, offered to try to find out.

After Dr. Bazil stepped into an uptown A train on a recent morning, he tried to guess what stage of sleep the nappers onboard were in. He said that to reach Stage 1 sleep, the least restorative of the five stages, riders must be able to slow down their eye movements. To get Stage 2 sleep, riders must relax their muscles and stop moving their eyes entirely.

As Dr. Bazil watched the riders sitting across from him, the nappers’ eyelids fluttered when train doors opened. The riders also seemed to clench their messenger bags and backpacks with death grips.

“I suspect all you get is Stage 1 sleep; it’s not going to be restorative,” he said. “It’s kind of wasted sleep.”

At a reporter’s request, Dr. Bazil wired up a sleepy subway rider to study his brain waves as he tried to nap. He enlisted Dr. Brandon Foreman, a 30-year-old neurology fellow, whose 2-year-old son, Jude, still does not sleep through the night. Neither does Dr. Foreman.

But he has observed how the subway lulls his son to sleep, so he tries to replicate the train’s stops and jerks when he puts his son to bed. Dr. Foreman is no stranger to subway napping: He began doing so when commuting from Brooklyn during his residency, and said he coveted any sleep he could get.

“Lectures, classes, I can pretty much sleep anywhere,” Dr. Foreman said. “But it’s not usually a great sleep. It’s more the nodding off.”

Both doctors met at the end of a long workweek after Dr. Foreman had been up every night dealing with his son’s cold. As Dr. Foreman yawned, Dr. Bazil had a technician attach 25 multicolored plastic wires to Dr. Foreman’s head, connecting them to a monitor slightly larger than an iPod to track his brain waves. Then Dr. Foreman covered the wires with a long sock and a winter hat.

The pair got onto a southbound A train at 207th Street. After Dr. Foreman chose a corner seat, Dr. Bazil sat across from him to take notes. When the train left the station at 6:09 p.m., it seemed unlikely that Dr. Foreman would get any sleep. The train’s operator screeched the cars along as if she were training for Formula One. She shouted into the loudspeakers that her train was late, and peeled from stop to stop.

Dr. Foreman yawned, folded his arms, crossed his legs and shut his eyes. He opened his eyes when the train stopped. His eyes fluttered when several neurologists boarded and chatted over his shoulder. The train jostled. He opened his eyes and yawned deeply.

By 6:18 p.m., two minutes after Dr. Foreman left the 168th Street station, he looked as if he was falling asleep. He first held his head up and kept his arms crossed. But he let his head nod back and forth slightly. Then his head fell, and he dozed until 59th Street — no doubt aided by the uninterrupted run from 125th Street. As the doors opened at 59th Street, Dr. Foreman jumped up and hopped off the train.

After they briefly celebrated what looked like a successful subway nap, the doctors boarded an uptown train to see if Dr. Foreman could fall asleep again. Dr. Foreman found a seat lodged between two passengers. He put on his jacket hood, crossed his legs, folded his arms and let his head fall. While the conductor was quieter on this train, Dr. Foreman could not get back to sleep. At 145th Street, when a vendor stood before him and shouted that he was selling four DVDs for $10, Dr. Foreman opened his eyes widely.

“No luck,” he said.

Dr. Bazil was more pleased with the results. After downloading the data about Dr. Foreman’s brain waves, Dr. Bazil found that Dr. Foreman had slept for 10 minutes out of a 23.5-minute ride. For three and a half minutes, Dr. Foreman reached a Stage 2 level of sleep.

“It looks like it is definitely possible to get small amounts of restorative sleep on the subway, but only very small amounts,” Dr. Bazil said. He added that some studies show “even a brief nap that includes Stage 2 sleep can improve performance.”

But Dr. Foreman was less persuaded that he got any productive sleep.

“I don’t feel rested,” he said. “It’s not like I took a nap in bed.”
Fuente: The New York Times

LEY Nº 1.540 de Contaminacion Sonora

2011-12-23T22:17:00.001-08:00

La Legislatura de la Ciudad Autónoma de Buenos Aires

sanciona con fuerza de Ley

Control de la Contaminación Acústica en la Ciudad Autónoma de Buenos Aires

Título I

Disposiciones generales

Artículo 1º.- Objeto. El objeto de esta Ley es prevenir, controlar y corregir, la contaminación acústica que afecta tanto a la salud de las personas como al ambiente, protegiéndolos contra ruidos y vibraciones provenientes de fuentes fijas y móviles, así como regular las actuaciones específicas en materia de ruido y vibraciones en el ámbito de competencia de la Ciudad Autónoma de Buenos Aires.

Artículo 2º.- Consideración. A los efectos de esta Ley se considera a los ruidos y a las vibraciones como una forma de energía contaminante del ambiente. Se entiende por contaminación acústica a la introducción de ruidos o vibraciones en el ambiente habitado o en el ambiente externo, generados por la actividad humana, en niveles que produzcan alteraciones, molestias, o que resulten perjudiciales para la salud de las personas y sus bienes, para los seres vivos, o produzcan deterioros de los ecosistemas naturales.

Artículo 3º.- Ámbito de aplicación y alcance. Queda sometida a las disposiciones de esta Ley, cualquier actividad pública o privada y, en general, cualquier emisor acústico sujeto a control por parte del Gobierno de la Ciudad de Buenos Aires que origine contaminación por ruidos y vibraciones que afecten a la población o al ambiente y esté emplazado o se ejerza en el territorio de la Ciudad Autónoma de Buenos Aires, sin perjuicio de lo establecido por la legislación vigente en materia de seguridad e higiene en el trabajo y otras normativas de aplicación.

Artículo 4º.- Definiciones. A los efectos de esta Ley, los conceptos y términos básicos referentes a ruido y vibraciones quedan definidos en el Anexo I.

Artículo 5º.- Autoridad de Aplicación. Es Autoridad de Aplicación de la presente Ley, la dependencia con competencia ambiental del Poder Ejecutivo, la que debe actuar en forma coordinada con otros organismos o dependencias cuyas competencias tengan vinculación con el objeto de la presente Ley.

Artículo 6º.- Competencias de la Autoridad de Aplicación. Compete a la Autoridad de Aplicación:

La reglamentación de la presente Ley.
El control, inspección y vigilancia de las actividades reguladas en esta Ley.
El ejercicio, de conformidad con lo previsto en la legislación aplicable, de la potestad sancionadora, en las materias que regula esta Ley.
Establecer el Plan de Actuación.
La delimitación de las áreas de sensibilidad acústica.
Fijar los límites de emisión e inmisión y los límites de vibraciones.
Propender mecanismos de coordinación interjurisdiccional con relación a los estándares y límites de emisión e inmisión, tecnología, capacitación y equipamiento a tener en cuenta en la revisión técnica periódica y en el control técnico aleatorio de fuentes móviles libradas al tránsito, o su equivalente, a los fines de homologar la normativa vigente.

Artículo 7º.- Información al público. Toda persona física o jurídica tiene derecho, sin obligación de acreditar un interés determinado, a acceder a la información sobre el ambiente en el ámbito de la Ciudad de Buenos Aires, conforme lo establecido en la Leyes Nros. 104, B.O.C.B.A. Nº 1041 del 4/10/00 y 303, B.O.C.B.A. Nº 858 del 13/1/00. La Autoridad de Aplicación desarrollará mecanismos de información a la población sobre la incidencia de la contaminación acústica en la Ciudad Autónoma de Buenos Aires.

Artículo 8º.- Plan de actuación. La Autoridad de Aplicación, en el plazo de trescientos sesenta y cinco (365) días, establecerá un plan permanente en materia de ruido y vibraciones, el que será revisado y actualizado en períodos no superiores a cinco (5) años a partir del establecimiento de los ECAs. Dicho plan concretará las líneas de actuación a poner en práctica y que harán referencia, entre otros, a los siguientes aspectos:

La elaboración de programas para la prevención, el control y la corrección de la contaminación acústica.
Información y concientización del público.
Elaboración de mapas de ruido y vibraciones como primera herramienta de diagnóstico.
Establecimiento de un catálogo de actividades potencialmente contaminantes por ruido y vibraciones.
Procedimiento de revisión.
Mecanismos de financiamiento.
Determinación de los Estándares de Calidad Acústica (ECAs) asociados a los límites de emisión e inmisión de ruidos y vibraciones, a alcanzar gradualmente en períodos verificables de dos (2) años a partir de la vigencia de la presente Ley.
Definición de planes de conservación para áreas de protección.

Artículo 9º.- Delimitación de las áreas de sensibilidad acústica. La delimitación de las áreas de sensibilidad acústica a las que se refiere el art. 6º inc. 5 de la presente Ley, requerirá la emisión de un informe documentado por parte de la Autoridad de Aplicación.

Título II

Inmisiones y emisiones acústicas

Artículo 10.- Valoración. La valoración de los niveles de inmisión y emisión de ruidos y vibraciones producidas por los emisores acústicos, se realizará conforme a los procedimientos establecidos en la reglamentación de la presente Ley, la cual podrá tomar como referencia las normas IRAM correspondientes.

Artículo 11.- Áreas de sensibilidad acústica. A los efectos de la aplicación de esta Ley, la clasificación de las áreas de sensibilidad acústica será la siguiente:

Ambiente exterior:
Tipo I: área de silencio zona de alta sensibilidad acústica, que comprende aquellos sectores que requieren una especial protección contra el ruido tendiente a proteger y preservar zonas de tipo:
a) Hospitalario.
b) Educativo.
c) Áreas naturales protegidas.
d) Áreas que requieran protección especial.
Tipo II: área levemente ruidosa.
Zona de considerable sensibilidad acústica, que comprende aquellos sectores que requieren una protección alta contra el ruido con predominio de uso residencial.
Tipo III: área tolerablemente ruidosa.
Zona de moderada sensibilidad acústica, que comprende aquellos sectores que requieren una protección media contra el ruido con predominio de uso comercial.
Tipo IV: área ruidosa.
Zona de baja sensibilidad acústica, que comprende aquellos sectores que requieren menor protección contra el ruido con predominio de uso industrial.
Tipo V: área especialmente ruidosa.
Zona de muy baja sensibilidad acústica, que comprende aquellos sectores afectados por infraestructuras de transporte (público automotor de pasajeros, automotor, autopistas, ferroviario, subterráneo, fluvial y aéreo) y espectáculos al aire libre.
A fin de evitar que colinden áreas de muy diferentes sensibilidad se deben establecer zonas de transición.
Ambiente interior
Tipo VI: área de trabajo.
Zona del interior de los ambientes de trabajo que comprende las siguientes actividades: sanidad, docente, cultural, oficinas, comercios e industrias, sin perjuicio de la normativa específica en materia de seguridad e higiene en el trabajo.
Tipo VII: área de vivienda.
Zona del interior de las viviendas y usos equivalentes, en la que se diferenciará entre la zona habitable, que incluye dormitorios, salones, despachos y sus equivalentes funcionales y la zona de servicios, que incluye cocinas, baños, pasillos, aseos, patios, centros libre de manzana, terrazas y sus equivalentes funcionales.

Artículo 12.- Niveles de evaluación sonora. A los efectos de esta Ley se establecen los siguientes niveles de evaluación sonora:

Nivel de emisión de ruido de fuentes fijas al ambiente exterior.
Nivel de inmisión de ruido de fuentes fijas en ambiente interior.
Nivel de emisión de ruido de las fuentes móviles.
Nivel de inmisión de transmisión de vibraciones en ambiente interior.

Artículo 13.- Valores Límite Máximos Permisibles (LMP).
La Autoridad de Aplicación, en el plazo de trescientos sesenta y cinco (365) días, debe establecer los valores máximos permisibles a alcanzar como metas u objetivos de calidad acústica. Hasta tanto se determinen dichos valores se utilizarán como referencia las tablas contempladas en el art. 47 de la presente Ley.

Artículo 14.- Períodos de referencia para la evaluación. A efectos de la aplicación de esta Ley, se considerarán los siguientes períodos horarios:

Como período diurno el comprendido entre las 7.01 y las 22 horas.
Como período nocturno el comprendido entre las 22.01 y las 7 horas.

La Autoridad de Aplicación reglamentará las zonas y horarios de fines de semana y feriados.

Título III

Prevención de la contaminación acústica

Artículo 15.- Evaluación de la incidencia acústica sobre el medio ambiente.
Las disposiciones de la presente Ley serán de aplicación para la determinación de la incidencia acústica sobre el ambiente, de las actividades catalogadas como potencialmente contaminantes por ruidos y vibraciones sin perjuicio de lo normado por la Ley Nº 123 B.O.C.B.A. Nº 622 del 1º/2/99 y sus modificatorias.

Artículo 16.- Registro de actividades catalogadas como potencialmente contaminantes por ruido y vibraciones.
La Autoridad de Aplicación, en el plazo de trescientos sesenta y cinco (365) días, creará un registro de actividades catalogadas como potencialmente contaminantes por ruidos y vibraciones en el que deberán inscribirse los titulares de las actividades involucradas habilitadas o por habilitarse.

Artículo 17.- Inscripción. Para la inscripción en dicho registro será necesaria la presentación, con carácter de Declaración Jurada, de un Informe de Evaluación de Impacto Acústico de la actividad sobre el ambiente firmado por un profesional inscripto en el Registro de Consultores y Profesionales en Auditorias y Estudios Ambientales de la Ley Nº 123.
Para las actividades catalogadas y categorizadas como Sin Relevante Efecto según la Ley Nº 123, modificada por la Ley Nº 452, B.O.C.B.A. Nº 1025 del 12/9/00, y la reglamentación vigente, y que no requieran de la presentación de un Estudio de Impacto Ambiental, deberán presentar el Informe de Impacto Acústico mencionado con carácter previo a su habilitación ante la Autoridad de Aplicación de la presente Ley.

Artículo 18.- Informe. En el Informe de Evaluación de Impacto Acústico se analizarán como mínimo los siguientes aspectos:

Nivel de ruido en el estado preoperacional, mediante la elaboración de mapas de los niveles acústicos en el ambiente exterior durante los períodos diurno y nocturno.
Nivel de ruido en el estado operacional, mediante la elaboración de mapas de los niveles acústicos en el ambiente exterior durante los períodos diurno y nocturno.
Evaluación del impacto acústico previsible de la nueva actividad, mediante comparación del nivel acústico en los estados operacional y preoperacional.
Comparación de los niveles acústicos en los estados preoperacional y operacional con los valores límite definidos en la reglamentación de la presente Ley.
Definición de las medidas correctoras del impacto acústico a implantar en la nueva actividad, en caso de resultar necesarias como consecuencia de la evaluación efectuada.
Presentación de una Memoria Técnica que contendrá como mínimo lo siguiente:
6.1. Descripción del tipo de actividad y horario previsto de funcionamiento.
6.2. Descripción de los locales en los que se va a desarrollar la actividad, así como (en su caso) los usos de los adyacentes y su situación respecto a viviendas u otros usos sensibles.
6.3. Características de las fuentes de contaminación acústica de la actividad.
6.4. Declaración que, una vez puesta en marcha, la actividad no producirá niveles de inmisión que incumplan los objetivos de calidad establecidos para las áreas de sensibilidad acústica aplicables.
6.5. Planos de situación.
6.6. Descripción detallada de medidas correctoras.

Artículo 19.- Medición. Las mediciones de los niveles acústicos en el estado preoperacional se realizarán de acuerdo con las prescripciones contenidas al respecto en esta Ley. La evaluación de los niveles de ruido en el estado operacional se realizará con la ayuda de modelos de predicción (u otros sistemas técnicamente adecuados) a los diferentes emisores implicados.
La Autoridad de Aplicación determinará los modelos o sistemas válidos en cada caso.

Artículo 20.- Criterios generales para la determinación de medidas correctoras de las actividades catalogadas.
Con carácter general, será preciso incorporar medidas correctoras de la contaminación acústica a aquellas actividades catalogadas cuyos niveles acústicos estimados para el estado operacional superen los valores límites establecidos en esta Ley y en su reglamentación.
Las medidas correctoras necesarias se establecerán otorgando prioridad al control de ruido en la fuente o en su propagación, frente a la adopción de medidas correctoras en los receptores. Las medidas correctoras en los receptores habrán de garantizar que los niveles de inmisión de ruido en ambiente interior no superarán lo establecido en la Reglamentación y en las Cláusulas Transitorias hasta tanto la Autoridad de Aplicación determine dichos valores.
Los costos asociados al estudio, proyecto e implantación de medidas correctoras de la contaminación acústica en los receptores correrán a cargo del promotor de la actividad una vez sean aprobadas.

Artículo 21.- Áreas de protección de sonidos de origen natural. La Autoridad de Aplicación deberá delimitar áreas de protección de sonidos de origen natural, las cuales serán identificadas como Lugares Vulnerables al Ruido, entendiendo por tales aquellos en que la contaminación acústica producida por la actividad humana sea imperceptible o pueda ser reducida hasta tales niveles.
En estas áreas, la Autoridad de Aplicación establecerá planes de conservación que incluyan la definición de las condiciones acústicas de tales zonas y adoptar medidas dirigidas a posibilitar la percepción de sonidos de origen natural.

Artículo 22.- Transporte. Todos los proyectos o modificaciones de los recorridos actuales de transporte, público y privado, y vías de circulación entre las que se incluyen las autopistas, autovías, carreteras, líneas férreas, aeropuertos, subterráneos y puertos incluirán un estudio específico de impacto acústico, medidas para la prevención y reducción de la contaminación acústica mediante la investigación e incorporación de mejoras tecnológicas en las cuestiones de instalaciones, en el desarrollo de actividades, en los procesos de producción y productos formales, constitutivos de fuentes sonoras.

Artículo 23.- Mapas de ruido. A fin de conocer la situación acústica dentro del Ámbito de la Ciudad Autónoma de Buenos Aires y poder actuar consecuentemente, la Autoridad de Aplicación, establecerá un programa permanente de medición de los niveles de ruido en el ambiente exterior en las zonas de mayor concentración urbana consideradas como los más afectados por la contaminación acústica. Los resultados de tales mediciones se presentarán en forma de mapas de ruido, los que se confeccionarán de acuerdo con métodos normalizados establecidos en la reglamentación de esta Ley, y deberán actualizarse cada cinco (5) años a partir de la aprobación de la presente Ley.
Los mapas de ruido deberán contener, como mínimo, la representación de los datos relativos a los siguientes aspectos,

Situación acústica existente, anterior o prevista expresada en función de un indicador de ruido.
Superación de un valor límite ("mapa de conflicto").
Número de viviendas en una zona dada que están expuestas a una serie de valores de un indicador de ruido.
Número de personas afectadas (molestias sonoras, alteración del sueño, etc.) en una zona dada.
Relaciones costos-beneficios u otros datos económicos sobre las medidas correctoras o los modelos de lucha contra el ruido.

Los mapas de ruido podrán presentarse en forma de:

Gráficos.
Datos numéricos en cuadros.
Datos numéricos en formato electrónico.

Los mapas de ruido servirán de:

Base para los datos.
Fuente de información destinada a los ciudadanos con arreglo al art. 7º de la presente Ley.
Fundamento de los planes de acción del Gobierno de la Ciudad Autónoma de Buenos Aires.

Título IV

Criterios sobre actividades específicas potencialmente contaminantes por ruido y vibraciones

Artículo 24.- Ruido de vehículos. Todo vehículo de tracción mecánica deberá tener en buenas condiciones de funcionamiento los elementos capaces de producir ruidos, con la finalidad de que el nivel sonoro emitido por el vehículo en su situación más desfavorable de marcha no exceda los valores límite de emisiones establecidos en la Reglamentación, o en las Cláusulas Transitorias de la presente Ley hasta tanto la Autoridad de Aplicación determine los mismos.

Artículo 25.- Revisión técnica periódica. A efectos de dar cumplimiento al artículo precedente se establece que las fuentes móviles libradas al tránsito deben estar sujetas a la revisión técnica periódica a fin del control de emisión de ruido y vibraciones propias del vehículo.

Artículo 26.- Revisión técnica aleatoria. La Autoridad de Aplicación debe realizar controles técnicos aleatorios sobre las fuentes móviles libradas al tránsito, en cualquier punto de su recorrido, sobre emisión de ruidos.

Artículo 27.- Trabajos en la vía pública. A los fines de no producir contaminación acústica, los trabajos realizados en la vía pública, actividades de carga y descarga de mercadería, las obras públicas y privadas, se ajustarán a las siguientes prescripciones:

El horario de trabajo de dichas actividades será dentro del período diurno, según se define tal período en esta Ley.
Se deben adoptar las medidas oportunas para evitar que se superen los valores límites de emisión. Las actividades contempladas en este artículo que justifiquen técnicamente la imposibilidad de respetar dichos valores necesitarán una autorización expresa por parte de la Autoridad de Aplicación.
Se exceptúan de la obligación establecida en el punto a):
I. Las obras de reconocida urgencia.
II. Las obras y trabajos que se realicen por razones de seguridad o peligro.
III. Las obras y trabajos que por sus inconvenientes o por razones operativas no puedan realizarse durante el período diurno.

El servicio público de higiene urbana debe adoptar las medidas y precauciones necesarias para cumplir con los límites establecidos en esta Ley.

Artículo 28.- Dispositivos acústicos. Los vehículos en servicio de los cuerpos y fuerzas de seguridad y policía, servicio de extinción de incendios y salvamentos y otros vehículos destinados a servicios de urgencia dispondrán de un mecanismo de regulación automática de la potencia sonora de sus dispositivos acústicos que permita, en función de la velocidad del vehículo, reducir los niveles de presión sonora de 90 dB(A) a 70 dB(A), medidos a 3 m de distancia.
Sus conductores limitarán el uso de los dispositivos de señalización acústica de emergencia a los casos de necesidad y cuando no sea suficiente la señalización luminosa.

Artículo 29.- Sistemas de alarma. El nivel sonoro máximo autorizado para cualquier sistema de aviso acústico instalado no podrá superar los 70 dBA, medido a 3 metros de distancia y en la dirección de máxima emisión.
Las alarmas instaladas deberán cumplir con las especificaciones técnicas en cuanto a niveles de emisión máxima, en cada una de las posibilidades de funcionamiento, tiempo máximo de emisión por ciclo de funcionamiento y secuencia de repetición que indique la certificación del fabricante.
La Autoridad de Aplicación reglamentará las condiciones a las que se deben ajustar los sistemas de aviso acústico.

Artículo 30.- Sistemas de propalación de sonido. Los sistemas de reproducción de sonido de que estén dotados los vehículos no podrán transmitir al ambiente exterior niveles sonoros superiores a los máximos autorizados en la reglamentación.
Se prohíbe la colocación de sistemas electroacústicos de propalación de sonido en la vía pública de carácter fijo o sobre instalaciones móviles, ya sea para difusión de música como de anuncios publicitarios y propaganda.
Se exceptúan las actividades culturales y de espectáculos en el espacio público, las que deben contar con su aprobación por la autoridad competente, de acuerdo con la normativa vigente.

Artículo 31.- Dispositivo de señalización acústica. Los vehículos deberán estar provistos de un dispositivo de señalización acústica, símil bocina, de no más de dos tonos que suene simultáneamente, cuyo sonido, sin ser estridente ni prolongado, se oiga en condiciones de campo libre a cien (100) metros de distancia, debiendo cumplir en cuanto a sus límites y procedimientos de ensayo según lo establecido por la Norma CETIA 13 D 1 para cada una de las siguientes categorías de vehículos:

En los automóviles, vehículos de carga y de transporte público de pasajeros;
En las motocicletas, motonetas y bicicletas a motor;
Las ambulancias, vehículos policiales, de bomberos y los de brigadas de servicios públicos de apuntalamiento y derrumbe.

(Conforme texto Art. 1º de la Ley Nº 3013, BOCBA 3158 del 21/04/2009)

Artículo 32.- Condiciones acústicas particulares en actividades y edificaciones donde se generan niveles elevados de ruido.
En los establecimientos donde se ubiquen actividades o instalaciones que generen niveles sonoros interiores superiores a 70 dBA, se exigirán aislamientos acústicos más restrictivos, en función de los niveles de ruido producidos en el interior de las mismas y horario de funcionamiento. La Autoridad de Aplicación reglamentará las especificaciones técnicas que deben cumplir dichos aislamientos.
En establecimientos de espectáculos públicos, locales bailables y de actividades recreativas donde se superen los 80 dBA se debe colocar en lugar visible el siguiente aviso: "Los niveles sonoros en este lugar pueden provocarle lesiones permanentes en el oído".
Artículo 33.- Medidas preventivas y actuaciones sobre la circulación. Cuando en determinadas zonas o vías urbanas en las que, de forma permanente o a determinadas horas de la noche se aprecie una degradación notoria del medio por exceso de ruido y vibración imputables al tránsito, la Autoridad de Aplicación podrá restringir o limitar dicho tránsito.

Título V

Corrección de la contaminación acústica

Artículo 34.- Declaración de Zonas de Situación Acústica Especial

Las áreas en que se incumplan los objetivos de los ECAs que les sean de aplicación, aun observándose los valores límite de emisión de cada uno de los emisores acústicos, podrán ser declaradas por el Gobierno de la Ciudad Autónoma de Buenos Aires como Zonas de Situación Acústica Especial.
El procedimiento para la declaración de Zona de Situación Acústica Especial se iniciará de oficio.
Una vez comprobada la desaparición de las causas que provocaron la declaración de Zona de Situación Acústica Especial, la Autoridad de Aplicación levantará tal declaración.

Artículo 35.- Régimen de actuaciones en Zonas de Situación Acústica Especial.
En las Zonas declaradas de Situación Acústica Especial se perseguirá la progresiva reducción de los niveles de inmisión hasta alcanzar los objetivos de calidad sonora que les sean de aplicación.
En esta situación, se podrán adoptar, a tenor de las circunstancias, todas o algunas de las siguientes medidas:

No podrá autorizarse en la zona la puesta en marcha o modificación de un emisor sonoro que incremente los niveles de ruido existentes en tanto permanezcan las condiciones acústicas que originaron la declaración.
Se elaborarán programas zonales específicos para la progresiva mejora del medio ambiente sonoro, que garanticen el descenso de los niveles de inmisión. Estos programas contendrán las medidas correctoras a aplicar, tanto a los emisores acústicos como a las vías de propagación, los responsables implicados en la adopción de las medidas, la cuantificación económica de las mismas y, en su caso, un proyecto de financiación.
Para las edificaciones destinadas a usos hospitalarios o educativos, localizadas en Zonas de Situación Acústica Especial en las que se incumplan los objetivos de calidad acústica correspondientes a su ambiente interior, se establecerán ayudas dirigidas a fomentar programas específicos de reducción del nivel de inmisión de ruido en el ambiente interior, de acuerdo con lo establecido en el Título VI de la presente Ley.

Título VI

Instrumentos económicos

Artículo 36.- Medidas económicas, financieras y fiscales. El Gobierno de la Ciudad Autónoma de Buenos Aires, en el ámbito de sus respectivas competencias, podrá establecer las medidas económicas, financieras y fiscales adecuadas para la prevención de la contaminación acústica, así como para promover programas, procedimientos y tecnologías de reducción de la contaminación acústica. Asimismo, podrán establecer incentivos a la investigación y desarrollo en materia de sistemas, métodos y técnicas de medida, análisis y evaluación de la contaminación acústica.
El Gobierno de la Ciudad Autónoma de Buenos Aires promoverá, el uso de maquinaria y equipos de baja emisión acústica, en particular en el marco de la contratación pública.

Título VII

Poder de Policía

Artículo 37.- Inspección, vigilancia y control. Corresponde a la Autoridad de Aplicación, ejercer el control del cumplimiento de esta Ley, exigir la adopción de medidas correctoras, señalar limitaciones, realizar inspecciones e imponer las sanciones correspondientes en caso de incumplimiento, de conformidad con lo previsto en la legislación aplicable y conforme al reglamento de la presente Ley.

Artículo 38.- Inspección de los vehículos a motor. Los cuerpos de vigilancia e inspección, en el caso de verificar que una fuente móvil sobrepasa los valores límite de emisión permitidos, labrarán el acta de comprobación correspondiente, e intimarán al titular o al conductor a presentar el vehículo en el lugar y hora determinados para su reconocimiento e inspección. Este reconocimiento e inspección podrá referirse tanto al método de vehículo en movimiento como al del vehículo estático.

Artículo 39.- Procedimiento sancionador. La imposición de sanciones se realizará mediante la apertura de expediente sancionador, que se tramitará conforme a lo establecido en la legislación aplicable por razón de la materia.

Artículo 40.- Competencia. El ejercicio de la potestad sancionadora por incumplimiento de las obligaciones previstas en esta Ley corresponderá al Gobierno de la Ciudad Autónoma de Buenos Aires, en ejercicio de sus respectivas competencias, de conformidad con lo previsto en la legislación aplicable.

Artículo 41.- Responsables. Serán sancionados por hechos constitutivos de infracciones administrativas por el incumplimiento de las obligaciones reguladas en esta Ley las personas físicas o jurídicas que resulten responsables de los mismos, aun a título de mera inobservancia.
Cuando en la infracción hubieren participado varias personas y no sea posible determinar el grado de intervención de las mismas en la infracción, la responsabilidad de todas ellas será solidaria.
Los titulares o promotores de las actividades o establecimientos serán responsables solidarios del incumplimiento de las obligaciones previstas en esta Ley, por quienes estén bajo su dependencia.

Artículo 42.- Infracciones y sanciones. El incumplimiento de las obligaciones establecidas en esta Ley sancionará, cuando proceda, de conformidad con lo dispuesto en la legislación aplicable por razón de la materia.
Modifícase el punto 1.3.3. del Capítulo III, Sección 1º, Libro II del Anexo I, de la Ley Nº 451, el que quedará redactado de la siguiente manera:
1.3.3.- El/la titular o responsable del establecimiento o inmueble desde el que se produzcan ruidos y vibraciones, por encima de los niveles permitidos, es sancionado/a con multa de $ 200 a $ 5.000.
Cuando se trate de un edificio afectado al régimen de propiedad horizontal, y no pueda identificarse al responsable de la falta, la multa se aplica contra el consorcio de propietarios, o en forma solidaria contra todos los propietarios de los departamentos que conforman el edificio.
Cuando se trate de un establecimiento industrial o comercial o recreativo el titular o responsable es sancionado con multa de $ 2.000 a $ 30.000.
Cuando no se facilite el acceso a los agentes de la autoridad para realizar los controles pertinentes establecidos en la Ley de Control de la Contaminación Acústica, será sancionado con multa de $ 6.000 a $ 15.000.
Quien manipule los dispositivos del mecanismo de regulación automática de la potencia sonora de modo que altere sus funciones será sancionado con multa de $ 6.000 a $ 15.000.
El/la titular del establecimiento que ponga en funcionamiento actividades, equipos con orden de cese o clausura en vigor, será sancionado con multa de $ 6.000 a $ 15.000.
El/la titular del establecimiento que ponga en funcionamiento actividades, instalaciones o equipos permanentes productores de ruidos, que no cuentan con habilitación correspondiente, y exceden los niveles permitidos de emisión e inmisión y vibración será sancionado con multa de $ 6.000 a $ 15.000.
Quien incumpla con las condiciones de aislamiento acústico o vibratorio establecidas en la habilitación correspondiente será sancionado con multa de $ 6.000 a $ 15.000.
Quien falsee los datos de los proyectos, certificados o estudios acústicos establecidos para la concesión de la habilitación será sancionado con multa de $ 6.000 a $ 15.000.
En todos los casos, además de la multa puede procederse al decomiso de los elementos que produzcan la emisión contaminante, y/o clausura del establecimiento y/o inhabilitación de hasta diez (10) días.

Artículo 43.- Graduación de las multas. Las multas correspondientes a cada clase de infracción se graduarán teniendo en cuenta, como circunstancias agravantes, la valoración de los siguientes criterios:

El riesgo de daño a la salud de las personas.
La alteración social a causa de la actividad infractora.
El beneficio derivado de la actividad infractora.
Las circunstancias dolosas o culposas del causante de la infracción.
Infracciones en zonas acústicamente saturadas.
La reiteración de dos o más infracciones leves de grado máximo en el período de un (1) año.

Tendrá la consideración de circunstancia atenuante de la responsabilidad, la adopción espontánea, por parte del autor de la infracción, de medidas correctoras con anterioridad a la incoación del expediente sancionador.

Cláusulas Transitorias

Artículo 44.- En el plazo de ciento ochenta (180) días de puesta en vigencia de la presente Ley, el Poder Ejecutivo realizará las modificaciones requeridas por la reglamentación de la Ley Nº 123 de Evaluación de Impacto Ambiental, para llevar a cabo la correcta aplicación de la Evaluación de Impacto Ambiental Acústico, para prevenir y reducir la contaminación acústica por ruido y vibraciones en los futuros emprendimientos, o los sujetos a dicha evaluación que se encuentran en funcionamiento.

Artículo 45.- El Poder Ejecutivo debe reglamentar la presente en el término de ciento ochenta (180) días a partir de su publicación, salvo aquellos puntos para los que la presente Ley establezca plazos determinados.

Artículo 46.- La Autoridad de Aplicación hasta cumplimentar lo establecido en el art. 13 de la presente Ley, referido a los Límites Máximos Permisibles de Ruido y los Valores Límites de Transmisión de Vibraciones, utilizará los parámetros indicados en las siguientes tablas:

Ambiente exterior
En el ambiente exterior ningún emisor acústico podrá producir niveles de inmisión sonoros que excedan los LMP’s establecidos en la tabla siguiente:

Área de sensibilidad acústica
VALORES LÍMITE EXPRESADOS EN LAeq,T

Período diurno (15 hs.)

Período nocturno (9 hs.)
Tipo I (Área de silencio)

60

50
Tipo II (Área levemente ruidosa)

65

50
Tipo III (Área tolerablemente ruidosa)

70

60
Tipo IV (Área ruidosa)

75

70
Tipo V (Área especialmente ruidosa)

80

75

Ambiente interior
En el ambiente interior ningún emisor acústico podrá producir niveles de inmisión sonoros que excedan los LMP’s establecidos en la tabla siguiente:
Área de sensibilidad acústica

Uso predominante del recinto

VALORES LÍMITE EXPRESADOS EN tLAeq,T
Período diurno (15 hs.)

Período nocturno (9 hs.)
Tipo VI (Área de trabajo)
Sanitario

50

40
Tipo VI (Área de trabajo)
Docente

50

50
Tipo VI (Área de trabajo)
Cultural

50

50
Tipo VI (Área de trabajo)
Oficinas

55

55
Tipo VI (Área de trabajo)
Comercios

60

60
Tipo VI (Área de trabajo)
Industria

60

60
Tipo VII (Área de vivienda)
Zona habitable

50-60*

40-50*
Tipo VII (Área de vivienda)
Zona de servicios

55-65*

45-55*

* De acuerdo con el Área de Sensibilidad Acústica donde se encuentre localizada la vivienda. Los primeros valores corresponden a áreas con predominio de uso residencial. Los segundos valores, a áreas con predominio de usos no residenciales, comerciales e industriales.
Para actividades no mencionadas en las tablas anteriores, los límites de aplicación serán los establecidos por usos similares regulados.
Valores límite de emisión de ruido de fuentes móviles.
Nivel sonoro de ruido emitido según método dinámico (Norma IRAM AITA 9 C).

Vehículos destinados al transporte de personas con capacidad de hasta 8 plazas sentadas como máximo, además del asiento del conductor 77 dBA.
Vehículos destinados al transporte de personas con capacidad para más de 8 plazas sentadas como máximo, además del asiento del conductor con un peso máximo no mayor de 3.5 toneladas 79 dBA.
Vehículos destinados al transporte de personas con capacidad para más de 8 plazas sentadas como máximo, además del asiento del conductor, con un peso máximo que exceda de 3.5 toneladas 80 dBA.
Vehículos destinados al transporte de personas con capacidad para más de 8 plazas sentadas, además del asiento del conductor, cuyo motor tenga una potencia igual o superior a 150 Kw 83 dBA.
Vehículos destinados al transporte de mercancías que tengan un peso máximo que no exceda las 12 Tn. 84dBA
Vehículos destinados al transporte de mercancías que tengan un peso máximo que exceda las 12 Tn. 86 dBA.
Motocicletas y ciclomotores con cilindrada menor o igual a 80 cm3 78 dBA.
Motocicletas y ciclomotores con cilindrada entre 81 y 125 cm3 80 dBA.
Motocicletas y ciclomotores con cilindrada entre 126 y 350 cm3 83 dBA.
Motocicletas y ciclomotores con cilindrada entre 350 y 500 cm3 85 dBA.
Motocicletas y ciclomotores con cilindrada mayor a 500 cm3 86 dBA.

Ningún vehículo en circulación podrá emitir un nivel sonoro de ruido que sea mayor al valor de referencia homologado, según el método estático, para cada configuración de vehículo, con una tolerancia de tres decibeles A (3 dBA) para los incisos a., b.,c.,d.,e. y f. y de dos decibeles A (2 dBA) para los incisos g.,h.,i.,j. y k., con la finalidad de cubrir la dispersión de producción, la influencia del ruido ambiente en la medición de verificación y la degradación admisible en la vida del sistema de escape. Para toda configuración de vehículo en el que el valor no sea homologado por el fabricante o importador por haber cesado en su producción, regirá el valor máximo declarado por el fabricante o importador en la respectiva categoría.
La medición del nivel sonoro de ruido emitido, según el método estático, se efectuará aplicando la norma IRAM-AITA 9 C-1.

Artículo 47.- De los ruidos provenientes de fuentes fijas transitorias.
Toda fuente de ruidos molestos de carácter transitorio, originados en la actividad personal o de máquinas, instalaciones, vehículos, herramientas, artefactos de naturaleza industrial de servicio, para poder operar deben bloquear los ruidos que originan con medios idóneos y adecuados a sus características para que no trasciendan con carácter de molestos, siendo su nivel máximo permitido el que corresponde a un ámbito de percepción predominantemente industrial.

Artículo 48.- Valores límite de transmisión de vibraciones al ambiente interior.
Ninguna fuente vibrante podrá transmitir vibraciones al ambiente interior cuyo índice de percepción de vibraciones K supere los valores establecidos en la siguiente tabla:
Área de sensibilidad acústica

Uso predominante del recinto

VALORES LÍMITE EXPRESADOS EN tLAeq,T
Período diurno (15 hs.)

Período nocturno (9 hs.)
Tipo VI (Área de trabajo)

Sanitario

1

1
Tipo VI (Área de trabajo)

Docente

2

2
Tipo VI (Área de trabajo)

Cultural

2

2
Tipo VI (Área de trabajo)

Oficinas

4

4
Tipo VI (Área de trabajo)

Comercios

8

8
Tipo VI (Área de trabajo)

Industria

10

10
Tipo VII (Área de vivienda)

Zona habitable

2

1,4
Tipo VII (Área de vivienda)

Zona de servicios

4

2

Artículo 49.- Derógase la Sección 5 de la Ordenanza Nº 39.025 A.D. 500.46, a excepción de los parágrafos 5.1.1.2 (Procedimiento de Medición para Fuentes Fijas), 5.1.1.3 (Instrumento de Medición), 5.1.2.2 (Procedimiento de Medición para Vibraciones) y el 5.1.2.3 (Instrumentos de Medición de Vibraciones), los que quedarán vigentes hasta la reglamentación de la presente Ley.

Artículo 50.- Los gastos que demande la presente Ley serán imputados en la jurisdicción 65 (Secretaría de Producción, Turismo y Desarrollo Sustentable) en el Programa 41, del Presupuesto para el Ejercicio del 2005.

Artículo 51.- Comuníquese, etc.

SANTIAGO DE ESTRADA

JUAN MANUEL ALEMANY

LEY Nº 1.540

Sanción: 02/12/2004

Promulgación: Decreto Nº 24/005 del 05/01/2005

Publicación: BOCBA Nº 2111 del 18/01/2005

Reglamentación: Decreto Nº 740/007 del 23/05/2007

Publicación: BOCBA Nº 2694 del 30/05/2007

DECRETO Nº 740/GCABA/07APRUEBA REGLAMENTACIÓN DE LA LEY N° 1.540, DE CONTROL DE LA CONTAMINACIÓN ACÚSTICA

2011-12-23T22:15:00.001-08:00

Boletín Oficial de la Ciudad Autónoma de Buenos Aires N° 2694
GOBIERNO DE LA CIUDAD AUTÓNOMA DE BUENOS AIRES

DECRETO Nº 740/GCABA/07APRUEBA REGLAMENTACIÓN DE LA LEY N° 1.540, DE CONTROL DE LA CONTAMINACIÓN ACÚSTICA

Buenos Aires, 23 de mayo de 2007

Visto la Ley N° 1.540 (B.O. N° 2111 de fecha 18/1/05), el Expediente N° 54.054/06, y

CONSIDERANDO

Que, la ley citada en el visto, tiene por objeto prevenir, controlar y corregir la contaminación acústica que afecta tanto a la salud de las personas, al medio ambiente y a las edificaciones, protegiéndolos contra ruidos y vibraciones provenientes de fuentes fijas y móviles, así como regular las actuaciones específicas en materia de ruido y vibraciones en el ámbito de la Ciudad Autónoma de Buenos Aires;

Que, la citada ley es de aplicación a cualquier actividad pública o privada y, en general, cualquier emisor acústico sujeto a control por parte del Gobierno de la Ciudad de Buenos Aires que origine contaminación por ruidos y vibraciones que afecten a la población, al ambiente o a las edificaciones y esté emplazado o se ejerza en el territorio de la Ciudad Autónoma de Buenos Aires, sin perjuicio de lo establecido por la legislación vigente en materia de seguridad e higiene en el trabajo y otras normativas de aplicación;

Que, por el artículo 45 de dicho cuerpo normativo, se establece que: El Poder Ejecutivo debe reglamentar la presente en el término de ciento ochenta (180) días a partir de su publicación, salvo aquellos puntos para los que la presente Ley establece plazos determinados;

Que, conforme al art. 5° de la ley, la autoridad de aplicación es la dependencia con competencia ambiental del Poder Ejecutivo, la que debe actuar en forma coordinada con otros organismos o dependencias cuyas competencias tenga vinculación con el objeto de la ley;

Que, el art. 25 de la Ley N° 1.925, creó el Ministerio de Medio Ambiente, estableciendo sus competencias, dentro de las cuales se encuentra la de Actuar como Autoridad de Aplicación de las leyes relacionadas con la materia ambiental (inciso g);

Que, en virtud de lo manifestado, y lo establecido en el artículo 6°, inciso 1 de la Ley N° 1.540, corresponde delegar en el Ministerio de Medio Ambiente la facultad para modificar los Anexos del presente decreto;

Que, en la elaboración del texto reglamentario se recogió la experiencia local sobre el tema, como así también, la normativa internacional, nacional y la aplicada en el ámbito de la Ciudad;

Que como referencia se tuvieron en cuenta las IRAM (Instituto Argentino de Normalización y Certificación), IEC (International Electrotechnical Commission) e ISO (International Organization for Standarization);

Que, la Procuración General de la Ciudad de Buenos Aires ha tomado la intervención de su competencia en los términos de la Ley N° 1.218;

Por ello, y en uso de las atribuciones conferidas por los artículos 102 y 104 de la Constitución de la Ciudad Autónoma de Buenos Aires,

EL JEFE DE GOBIERNO

DE LA CIUDAD AUTÓNOMA DE BUENOS AIRES

DECRETA:

Artículo 1° - Apruébase la reglamentación de la Ley N° 1.540, que como Anexos I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV y XV forman parte integrante del presente decreto.

Artículo 2° - Desígnase autoridad de aplicación de la Ley N° 1.540 de Control de la Contaminación Acústica al Ministerio de Medio Ambiente del Gobierno de la Ciudad de Buenos Aires.

Artículo 3° - Autorízase a la autoridad de aplicación, a modificar los aspectos técnicos-ambientales previstos en los Anexos aprobados por el art. 1° del presente decreto, previa coordinación con los organismos cuyas competencias tengan vinculación con las modificaciones a realizar.

Artículo 4° - La autoridad de aplicación coordinará con el Ministerio de Gobierno las acciones de control, inspección y vigilancia de las actividades reguladas por la normativa vigente.

Artículo 5° - El Ministerio de Hacienda, a través de la Oficina de Gestión Pública y Presupuesto, arbitrará las medidas necesarias a fin de dar cumplimiento al presente decreto.

Artículo 6° - El presente decreto es refrendado por los señores Ministros de Medio Ambiente, de Gobierno, de Planeamiento y Obras Públicas, de Hacienda y de Espacio Público.

Artículo 7° - Dése al Registro, publíquese en el Boletín Oficial de la Ciudad de Buenos Aires, comuníquese a los Ministerios de Gobierno, de Planeamiento y Obras Públicas y de Hacienda, a la Oficina de Gestión Pública y Presupuesto, y para su conocimiento y demás efectos pase al Ministerio de Medio Ambiente. Cumplido, archívese.

La Ley y el Ruido en la Provincia de Buenos Aires

2011-12-23T22:07:00.000-08:00

Conozca sus Derechos

Cansado de escuchar ruidos altos y sentir vibraciones molestas provenientes de propiedades linderas? Cansado de que perturben su tranquilidad y sueño?
Las respuestas a estas preguntas deberian ser negativas, pero, lamentablemente, para muchos de nosotros no las son.

Mientras que unos se aprovechan de la ignorancia de la sociedad y del silencio de las municipalidades otros se amparan del acostumbramiento a sufrir de estas molestias hasta tomarlas como algo común de sus vidas.

Pues esto no deberia suceder ya que existen leyes, ordenanzas y normas que amparan a los residentes de Buenos Aires de estas molestias. Por ende, para que las respuestas a las preguntas anteriores sean negativas, la sociedad debe concientizarse sobre estos reglamentos para conocer sus derechos civiles y poder reclamarlos justamente.

Dependiendo de la zona en la que reside en la Provincia de Buenos Aires rigen diferentes normativas. En la Ciudad Autonoma de Buenos Aires (CABA) rige la Ley 1,540/04 de control de la contaminacion Acustica con su Decreto Reglamentario 740/07.

Esta Ley determina los niveles de presion sonora y vibraciones que Fuentes Fijas (ya sean maquinas industriales, bares, boliches, etc.) y Fuentes Moviles (todo tipo de vehiculos) no deben superar, dependiendo de la zonificacion y horario, para que su emision sea tratada como perturbante a la sociedad.

Desafortunadamente no todos los municipios de la Provincia de Buenos Aires cuentan con una Ordenanza sobre ‘Ruidos Molestos’ asi como tambien con la Ley Provincial 159/96 de Contaminacion Sonora producida por Industrias.

Las que cuentan con dicha Ordenanza determinan los niveles maximos de presion Sonora que Fuentes fijas y moviles estan permitidos emitir dependiendo de la zonificacion y del horario.

Fuente: http://www.acusticalegal.com.ar

Información útil sobre ruidos en la CABA

2011-12-23T21:57:00.000-08:00

La afectación producida por el ruido es uno de los problemas que mayor dimensión tiene en el ámbito de las grandes ciudades, y muy especialmente en la Ciudad de Buenos Aires.

Para que usted tenga algunas referencias sobre la normativa existente le comentamos que:

A.- Todos los habitantes de la Ciudad, tienen reconocido el derecho a gozar de un ambiente sano; el mismo incluye la ausencia de contaminación sonora –como puede ser un caso de ruido excesivo-; así lo consagra la Constitución Nacional.

B.- La Ley nº 1540 de la Ciudad Autónoma de Buenos Aires establece los topes de emisiones sonoras, dividiendo a la ciudad en distintas zonas.

En el año 2007 fue reglamentada para comenzar a regir y aumentar el control de la problemática. La misma es de aplicación a cualquier actividad pública o privada.

En general, cualquier emisor acústico está sujeto a control por parte del Gobierno de la Ciudad de Buenos Aires que origine contaminación no sólo por ruidos, sino que además comprende vibraciones; que afecten a la población, al ambiente o a las edificaciones y esté emplazado o se ejerza en el territorio de la Ciudad Autónoma de Buenos Aires, sin perjuicio de lo establecido por la legislación vigente en materia de seguridad e higiene en el trabajo y otras normativas de aplicación.

Por otra parte, la ley, siguiendo el modelo establecido en diferentes legislaciones del mundo, establece que los valores de ruido deberán considerarse desde dos perspectivas.

1) Emisión sonora: Nivel de ruido producido por una fuente sonora, medido en su entorno conforme a un protocolo establecido.

2) Inmisión de ruido: Nivel de ruido producido por una o diversas fuentes sonoras, medido en la posición del receptor expuesto a la misma.

C.- En este sentido, el nivel de ruido en promedio tolerable dentro de una vivienda en general es de 55 dB durante el día y 45 dB en horario nocturno.

D.- La Organización Mundial de la Salud afirma que el parámetro de 70 a 80 dB permite fijar un umbral por sobre el cual se genera clara deficiencia auditiva. Y que no recomienda habitar en lugAres con ruidos superiores a 65 dBA.

El tema es sin duda complejo, ya que afecta a un gran número de personas y paradójicamente las autoridades han hecho muy poco para revertir la actual situación. En este contexto, la información adquiere un valor trascendente para que los vecinos conozcan cuales son los problemas y de qué manera poder ejercer los derechos que las leyes otorgan.

En tanto el artículo 82 del Código Contravencional de la Ciudad: Establece que quien perturba el descanso o la tranquilidad pública mediante ruidos que por su volumen, reiteración o persistencia excedan la normal tolerancia, es sancionado/a con uno (1) a cinco (5) días de trabajo de utilidad pública o multa de doscientos ($ 200) a un mil ($ 1.000) pesos.

Cuando la conducta se realiza en nombre, al amparo, en beneficio o con autorización de una persona de existencia ideal o del titular de una explotación o actividad, se sanciona a éstos con multa de seiscientos ($ 600) a diez mil ($ 10.000) pesos.

No constituye contravención: El ensayo o práctica de música fuera de los horarios de descanso siempre que se utilicen dispositivos de amortiguación del sonido de los instrumentos o equipos, cuando ello fuera necesario.

El Código Civil de la Nación, a su vez establece que, las molestias que ocasionen el ruido, vibraciones o daños similares por el ejercicio de actividades en inmuebles vecinos, no deben exceder la normal tolerancia teniendo en cuenta las condiciones del lugar y aunque mediare una autorización administrativa.

INFORMACION

El problema de los ruidos es que pueden producirse en intervalos no periódicos de tiempo; como también en determinadas circunstancias que puedan exceder a la normal tolerancia o autorización administrativa.
Debe tener en cuenta a fin de brindar una detallada información que permitan realizar mediciones en momentos estratégicos; pues, por ejemplo; si la molestia por ruidos es de una obra en construcción que los camiones descargan por la mañana, debe indicarse, a fin de que las inspecciones puedan ser realizadas en la franja horaria en cuestión.
Información a reunir de utilidad:

Localización de las fuentes de ruidos.
Horarios donde se producen. (Sea un local bailable; transporte que en un momento determinado del día pueda ser excesivo).
Habilitación de las fuentes emisoras.
En el caso de transporte, brindar información de la unidad (Dominio; Número de Interno).

ACERCA DEL RUIDO
a) ¿Qué es el ruido?
Es un sonido que interfiere con las actividades, las conversaciones o el descanso. Un mismo sonido puede ser música o diversión para una persona y ruido para otra.

b) ¿Cuáles son los efectos perjudiciales del ruido?
Hay efectos negativos sobre la salud en general (hipertensión arterial, mayor incidencia de accidentes cardiovasculares, alteraciones digestivas, alteraciones hormonales, alteraciones de la voz, estrés, alteraciones del crecimiento en los niños), sobre la salud auditiva (hipoacusia, socioacusia, profesoacusia, trauma acústico, acúfenos) y sobre las actividades humanas (pérdida de inteligibilidad por enmascaramiento, dificultades para la comunicación oral, trastornos del aprendizaje, pérdida de la concentración).

c) ¿Cuáles son los ruidos más perjudiciales para el oído?
Los ruidos de alta frecuencia (entre 1 kHz y 6 kHz) y gran intensidad, los ruidos explosivos, los ruidos de impacto y los ruidos con fuerte contenido tonal. También son potencialmente peligrosos los ruidos que obligan a gritar para comunicarse con la persona que está al lado de uno.

d) ¿Qué son los decibeles A y por qué se los utiliza tanto?
El decibel A (abreviado dBA) es una unidad de nivel sonoro medido con un filtro previo que quita parte de las bajas y las muy altas frecuencias. De esta manera, antes de la medición se conservan solamente los sonidos más dañinos para el oído, razón por la cual la exposición medida en dBA es un buen indicador del riesgo auditivo.

e) ¿Qué es el nivel sonoro continuo equivalente? ¿Y el nivel equivalente?
Son esencialmente lo mismo: el nivel promedio de un ruido. Más precisamente, un nivel constante a lo largo de un tiempo especificado (generalmente 8 horas ó 24 horas) que tiene la misma energía sonora que el ruido variable.

RUIDO POR LOCALES BAILABLES

Los niveles de presión acústica que emiten al exterior algunos salones de fiestas, discotecas, bares y otros establecimientos similares, plantean un problema de gran impacto vecinal. El ruido procede comúnmente de los aparatos reproductores de música grabada o de los amplificadores de conjuntos musicales, que puede verse agravado por le bullicio del publico que asiste a dichos establecimientos.

Este problema se agrava cuando los locales tienden a agruparse en determinadas zonas de la ciudad, propiciando además de ruido masivo y continuo, la saturación de la vía pública y congestionamientos de tránsito por falta de estacionamientos, entre otros.

Usted podría en su caso verificar si el local se encuentra habilitado ingresando a la pagina del Gobierno de la Ciudad Autónoma de Buenos Aires.

Si el local no estuviere habilitado: Las denuncias por problemas de seguridad y habilitación comercial pueden iniciarse desde el SUD (Sistema único de denuncias).

RUIDO DE UN DOMICILIO PARTICULAR

El ruido provocado por una fuente fija es el que afecta solamente a las personas que ocupan los inmuebles colindantes -y próximos al local donde se encuentran instalados los equipos generadores de ruido- . Las fuentes fijas ocasionan serias molestias vecinales cuando el ruido escapa fuera de los locales o se transmite a las viviendas e inmuebles vecinos, fundamentalmente por problemas de aislamiento, siendo un frecuente motivo de queja de parte de los habitantes de la ciudad.

En este caso es posible reclamar al 0800-999-2727, ante la Justicia Contravencional y de Faltas llamando al 0800–333-47225 (0800-FISCAL) las 24 horas del día o ante la Comisaría respectiva.

Además se puede recurrir al CGPC solicitando que intervenga el servicio de Mediación Comunitaria.

RUIDO PROVENIENTE DE UN LOCAL INDUSTRIAL Y/O COMERCIAL
El reclamo correspondiente se puede realizar llamando al 0800-999-2727, o a través del CGPC de su barrio. La Dirección General de Control de Calidad Ambiental (DGCCA) realiza las mediciones previa coordinación con el reclamante, en el domicilio del mismo y ante su presencia.
En materia contravencional, puede denunciarse la situación ante:

La Justicia Contravencional y de Faltas, llamando al 0800–333-47225 (0800-FISCAL) las 24hs. del día o
La Comisaría respectiva.

Nota: También es posible iniciar el reclamo online: Link
Se debe completar un formulario que llegará por e-mail al Call Center del Gobierno de la Ciudad. Allí se evaluará la pertinencia del reclamo y se ingresará como expediente para ser remitido al área de Gobierno responsable.
Al ciudadano se le enviará un correo donde se indicará el Nº de reclamo, el Centro de Gestión y Participación actuante y el Organismo ejecutor del reclamo. Estos datos le permitirán efectuar un seguimiento del trámite

RUIDO DE TRANSPORTE
La Dirección General Control de la Calidad Ambiental (DGCCA) tiene competencia en materia de control de ruidos y humos negros provenientes de fuentes móviles

El reclamo se puede realizar llamando al 0800-999-2727 o a través del CGPC.

Nota: Es conveniente indicar el número de interno y línea de la unidad y en el caso de motocicletas, automóviles, camionetas o camiones apuntar el número de patente.

Además es posible realizar la denuncia de ruidos de transporte público ante la Comisión Nacional de Regulación de Transporte –CNRT- pues las empresas de transporte deben respetar el nivel permitido de emisión de gases contaminantes y/o ruidos.

Ante la CNRT; puede realizar la denuncia de la siguiente manera:

Online: El usuario podrá ingresar en los formularios de denuncia habilitados para cada modo de transporte. Cuentan con campos de llenado obligatorio (marcados con *) que son necesarios para identificar al servicio y/o conductor sobre el cual presenta su reclamo, para su tramitación. Existen otros campos opcionales, que es recomendable completar para acreditar los hechos denunciados
Telefónicamente: a través de la línea gratuita 0800 - 333 - 0300 (de Lunes a Viernes de 8:00 a 20:00 horas).
Personalmente: En la sede central del organismo Maipú 88 – Planta Baja – CABA ; En la Estación Terminal de Ómnibus de Retiro – Oficinas 129 y 130 ubicadas en el Puente 4 – Nivel II.; ó; En las delegaciones regionales del interior del país.

Nota: La denuncia realizada telefónicamente puede ser anónima; por internet requiere ingresar un documento.

Respecto a los Subtes, se pueden realizar denuncias ante la Defensoría del Pueblo de la Ciudad Autónoma de Buenos Aires.

Fuente: Escrito por FARN (Fundación Ambiente y Recursos Naturales).
http://www.noticias-librodar.com.ar

España: piden pena de prisión para una mujer por molestar a sus vecinos con el piano

2011-12-23T21:48:00.000-08:00

España: piden pena de prisión para una mujer por molestar a sus vecinos con el piano

Está acusada de un delito contra el medio ambiente y otro de lesiones por los daños psicológicos que los ruidos del piano provocaron supuestamente a una vecina

BARCELONA.- Una joven española de 26 años se enfrenta a siete años y medio de prisión por presuntamente molestar a los vecinos tocando el piano y desoír los requerimientos para que insonorizaran la habitación donde practica.

La Fiscalía reclama esa pena para la joven intérprete y sus padres, vecinos del municipio de Puigcerdà, en Girona.

La familia está acusada de un delito contra el medio ambiente y otro de lesiones por los daños psicológicos que los ruidos del piano provocaron supuestamente a una vecina, que fue la que presentó la denuncia que dio pie a este proceso penal.

La elevada petición fiscal ha indignado al abogado de la defensa, que cree que se ha trasladado a la esfera penal un asunto que debería dirimirse a través del derecho administrativo o civil.

La Fiscalía pide también a la intérprete y sus padres el pago de una multa de 360 euros, así como otros 21.900 en concepto de indemnización para la vecina, y su inhabilitación para cualquier profesión relacionada con el uso de pianos.

Según el fiscal, desde octubre de 2003 hasta septiembre de 2007, la intérprete, "alentada y ayudada activamente por sus padres", tocó el piano en el domicilio familiar durante ocho horas diarias un mínimo de cinco días a la semana, en una habitación que no estaba adecuadamente insonorizada.

La música provocaba niveles de ruido "notablemente superiores" al límite de 30 decibelios en horario diurno que establece la Ley de Protección Contra la Contaminación Acústica para los instrumentos musicales, según el ministerio público.

En marzo de 2006, la vecina presentó una denuncia ante el Ayuntamiento de Puigcerdà, que en cuatro ocasiones, hasta febrero de 2007, requirió a la familia que cesara en la emisión de ruidos e insonorizara la habitación donde se encontraba el piano, aunque los acusados hicieron caso omiso de los mismos, según el fiscal.

Los ruidos causados por la pianista, según la acusación, ocasionaron un trastorno adaptativo con síntomas de ansiedad que derivaron en problemas de gestación en la última fase de su embarazo, lo que la obligó a someterse a terapia y a un tratamiento de ansiolíticos.

La mujer, que ejerce la acusación particular, estuvo medio año de baja por ese trastorno y tuvo que mudarse temporalmente a otro domicilio junto a su familia para conseguir una mejora de su estado de salud, mantiene la Fiscalía.

La intérprete, según publica hoy el periódico "La Vanguardia", compagina la formación musical con recitales y giras.

Su historia recuerda la del niño de 7 años al que la Guardia Urbana de Tarragona multó hace unos meses con 800 euros a raíz de las quejas vecinales que originaba cuando ensayaba con su trombón.
Fuente: diario la Nacion, Argentina
http://www.lanacion.com.ar/1435426-piden-pena-de-prision-para-joven-espanola-por-molestar-a-vecinos-con-el-piano
Fuente de la imagen: rosariocollico.blogspot.com

The association of the appetitive peptide acetylated ghrelin with alcohol craving in early abstinent alcohol dependent individuals

2011-12-17T16:06:00.000-08:00

Anne Koopmanna, , Christoph von der Goltza, b, 1, Martin Grosshansa, Christina Dintera, Meike Vitalea, Klaus Wiedemannc, Falk Kiefera

a Department of Addictive Behavior and Addiction Medicine, Central Institute of Mental Health, J5/68159 Mannheim, Germany
b Psychiatric Clinic, Kungälv Hospital, 44283 Kungälv, Sweden
c Department of Psychiatry, University Medical Center, Hamburg; Martinistr. 52; 20246 Hamburg, Germany

Available online 14 December 2011.

Summary
Objective

Recent preclinical and clinical studies suggested ghrelin to have an orexigenic role in regulating appetite and energy balance.

Preclinical studies also provided support for an important role of ghrelin in the neurobiology of addiction-related reward pathways, affecting the self-administration of alcohol and drugs as well as conditioned place preference.

In contrast, clinical data have until now failed to support an association between ghrelin and alcohol craving, possibly due to the fact that these studies have analyzed the pharmacologically inactive, preprohormone ghrelin instead of ghrelin in its active, acetylated form.

Materials and methods

Our study sample was a group of 61 alcohol-dependent male inpatients.

We assessed their plasma concentrations of both active and total ghrelin, using blood samples taken twice during the study: once at the onset of withdrawal, 12–24 h after admission, and then again after 14 days of controlled abstinence.

During this time, we also assessed the patients’ alcohol cravings (applying the obsessive compulsive drinking scale, or OCDS), symptoms of depression (Beck Depression Inventory; BDI) and anxiety (State Trait Anxiety Inventory; STAI). The severity of alcohol dependence was assessed using the alcohol dependence scale (ADS).
Results

We found a significant positive correlation between the plasma concentration of active ghrelin and alcohol craving in both blood samples.

Plasma concentrations of active ghrelin increased significantly during early abstinence. In a linear regression model, the plasma concentration of active ghrelin on day one, the scores of the ADS, and the BDI explained 36% of the variance in OCDS sum score (p < 0.0001).By day 14, these same factors accounted for 54% (p < 0.0001). We did not detect any association between the plasma concentration of total ghrelin and patients’ alcohol cravings.Conclusion

Our results suggest that biologically active, acetylated ghrelin is involved in reward-associated craving during alcohol withdrawal and early abstinence in alcohol-dependent patients.

Antagonizing ghrelin at its central growth-hormone secretagogue receptors (GHS-R1A) in the ventral tegmental area (VTA) may prove to be a novel pharmacological target in a future treatment for craving and relapse in alcoholics.

Keywords: Alcoholism; Ghrelin; Craving; Withdrawal; Addiction

Fuente: Psychoneuroendocrinology
http://www.sciencedirect.com/science/article/pii/S0306453011003350

Acúfenos en los medios; Mexico, la hieprtension, la diabetes y los acufenos El cuerpo es un todo

2011-12-17T15:59:00.000-08:00

Otorricomentarios
Publicada: 16 diciembre 2011

Los oídos no están aislados, de hecho ningún órgano lo está, todo conforma "un todo" en el maravilloso milagro de la vida humana y es por ello que enfermedades generales pueden repercutir en uno u otro lado.

La hipertensión arterial hace mella en muchos de los órganos de nuestro organismo: corazón, riñón, cerebro, y lo hace en gran medida afectando la circulación (oclusión de vasos sanguíneos), principalmente la microcirculación. Dos son las entidades, aunque sin duda son un sinnúmero de ellas, que tradicionalmente son etiquetadas como "enemigos silenciosos": la diabetes mellitus y la hipertensión arterial; infinidad de veces coincidentes en una misma persona.

Aunque un paciente con hipertensión puede manifestar dolor de cabeza, acúfenos (zumbidos de oídos), fosfenos (ver destellos luminosos), mareo, etcétera, no siempre sucede y en ello estriba el riesgo de la complicación (infartos, derrames cerebrales, sangrados nasales copiosos, pérdida de la visión o la audición, entre otras). Aconsejable es checarse la "tensión arterial" (presión) con cierta frecuencia y que el médico lo realice, siempre, durante su consulta.

*) Otorrinolaringología de niños y adultos. Consultorio 423 de Star Médica. 196-15-14.
Fuente: http://www.yucatan.com.mx/20111216/nota-7/212157-el-cuerpo-es-un-todo.htm

Programas de generadores de sonido para enriqueciemiento ambiental para acúfenos y otros usos

2011-12-17T15:49:00.000-08:00

http://virtualdreamer.com/tinnitus.html

Esta es una pagina Web con programas para general sonidos de enmascaramiento de acufenos o d enriquecimiento ambiental para acufenos o para dormir mejor, algunos productos son gratuitos.

Breaking the loop: Oxytocin as a potential treatment for drug addiction

2011-12-17T15:41:00.000-08:00

Iain S. McGregor , Michael T. Bowena

a School of Psychology, University of Sydney, NSW 2006, Australia

Available online 14 December 2011.

Fuente de la imagen: buy-oxytocin.com

Abstract

Drug use typically occurs within a social context, and social factors play an important role in the initiation, maintenance and recovery from addictions.

There is now accumulating evidence of an interaction between the neural substrates of affiliative behavior and those of drug reward, with a role for brain oxytocin systems in modulating acute and long-term drug effects.

Early research in this field indicated that exogenous oxytocin administration can prevent development of tolerance to ethanol and opiates, the induction of stereotyped, hyperactive behavior by stimulants, and the withdrawal symptoms associated with sudden abstinence from drugs and alcohol.

Additionally, stimulation of endogenous oxytocin systems is a key neurochemical substrate underlying the prosocial and empathogenic effects of party drugs such as MDMA (Ecstasy) and GHB (Fantasy).

Brain oxytocin systems exhibit profound neuroplasticity and undergo major neuroadaptations as a result of drug exposure.

Many drugs, including cocaine, opiates, alcohol, cannabis, MDMA and GHB cause long-term changes in markers of oxytocin function and this may be linked to enduring deficits in social behavior that are commonly observed in laboratory animals repeatedly exposed to these drugs.

Very recent preclinical studies have illustrated a remarkable ability of exogenously delivered oxytocin to inhibit stimulant and alcohol self-administration, to alter associated drug-induced changes in dopamine, glutamate and Fos expression in cortical and basal ganglia sites, and to prevent stress and priming-induced relapse to drug seeking.

Oxytocin therefore has fascinating potential to reverse the corrosive effects of long-term drugs abuse on social behavior and to perhaps inoculate against future vulnerability to addictive disorders.

The results of clinical studies examining intranasal oxytocin effects in humans with drug use disorders are eagerly awaited.
Highlights

► There is interaction between the neural substrates of affiliative behavior and those of drug reward.
► Oxytocin release may mediate the positive prosocial effects of drugs such as MDMA (Ecstasy).
► Oxytocin can inhibit drug and alcohol intake and also ameliorate drug withdrawal symptoms.

► Long term neuroadaptations in oxytocin systems may explain how social behavior is adversely affected by long-term drug abuse.
► Oxytocin receptopr agonists have potential as therapeutics for treating drug addiction and associated psychopathology.

Keywords: oxytocin; vasopressin; addiction; MDMA; alcohol; adaptation; pharmacotherapy; drug abuse; dopamine; tolerance; withdrawal; striatum

Corresponding Author Contact InformationCorresponding author. Fax: + 61 2 9351 8023.

Fuente: Hormones and Behavior,
http://www.sciencedirect.com/science/article/pii/S0018506X11002765

Sumergir los pies en el agua extremadamente fría provoca vasodilatación extracraneal ipsilateral

2011-12-17T15:27:00.000-08:00

Peter D. Drummond ,Cheryl Chunga

Escuela de Psicología de la Universidad de Murdoch, Perth, Western Australia, Australia

Disponible online: 01 de septiembre 2011.

fuente de la imagen: blog.physio-coach.co.uk
la amplitud del pulso tomado en la arteria temporal fue registrada en forma bilateral en 56 participantes, antes, durante y después de tres inmersiones de los pies, en agua helada.

A la mitad de los participantes se les dijo que la exposición prolongada a temperaturas de congelación puede causar quemaduras por congelación.

El aumento de la amplitud de pulso fue mayor en la arteria temporal del mismo lado del pié sumergido en agua helada que la tomada en la temporal contralateral durante y después de las tres de los piés .

A pesar que la amplitud del pulso disminuyó después , la respuesta vasodilatadora se mantuvo durante y algo después de las tres inmersiones.

Estos hallazgos indican que la estimulación nociceptiva del pie ipsilateral evoca una supra-espinal respuesta vasodilatadora extracraneal, posiblemente como parte de una respuesta de defensa más amplia.

Fuente: Autonomic Neuroscience
Volume 166, Issues 1-2, 26 January 2012, Pages 89-92

2011-12-17T15:13:00.000-08:00

Nippon Telegraph and Telephone (NTT) Corp says it is developing a consumer version of a galvanic vestibular stimulation machine. It uses electric current to cause your body to feel the need to move on demand.

A special headset sends a low voltage current from the back of your ears through your head - right to left or left to right, depending on what the person with the "human controller" joystick chooses to do.

Galvanic vestibular stimulation confuses the nerves in your ear to throw off your sense of balance. Since you feel unbalanced, you seek to orient your body properly. When the controller turns the switch to the right while you are walking, your body rebalances itself to veer to the right - without conscious thought.

According to researchers, it is possible to force a person to actually walk along a predetermined route - like a pretzel-shaped path - using the device.

(Remote Controlled Spock)

In looking around for science fictional antecedents to the idea of a remote control for a person, I recalled the Star Trek episode Spock's Brain, which aired September 20th, 1968. In the story, Spock's brain is actually stolen right out of his head by beautiful aliens, leaving the body behind. McCoy fixes up a device that lets him control Spock's brainless body remotely; he fiddles with the controls on the remote, and Spock walks.

Science fiction stories about mind control almost invariably include the idea of telepathy by an organic mind, rather than by a mechanical device. For example, the thought-screen from the 1940's novel Gray Lensman by E.E. "Doc" Smith is intended to protect the user from beings with mind control powers. Robert Heinlein, in his 1951 novel The Puppet Masters, writes about "slugs" from Titan that ride on a human being and take complete control of the brain and nervous system.

Philip K. Dick, in his excellent 1955 short story Service Call, writes about the swibble, which was a combination of living organism and electronics:

Swibble-culture is an organic phenotype evolved in a protein medium under controlled conditions. The directing neurological tissue that forms the basis of the swibble is alive, certainly, in the sense that it grows, thinks, feeds, excretes waste. Yes, it's definitely alive. But the swibble, as a functioning whole, is a manufactured item.
(Read more about Philip K. Dick's swibble)

More recently, the evil Plankton hopes to force Spongebob Squarepants to reveal the secret Krabby Patty formula by taking control of Spongebob's brain with a device labeled "Total Control" and forcing him to walk right out of his house.

(Plankton Takes Control Of Spongebob

I'm hoping that, by including this whimsical reference to a popular children's television show, any unfortunate paranoids who come upon this page will be reassured that this product will only be used for fun and games. Despite the fact that users of NTT's experimental device claim that "It's a mesmerizing sensation similar to being drunk or melting into sleep under the influence of anesthesia. But it's more definitive, as though an invisible hand were reaching inside your brain." Rest assured, though; you can even remote-control yourself by taking the device into your own hands.

Read more at Remote control device 'controls' humans; found it at /..

(Story submitted 10/25/2005)
Fuente: Technovelgy.com - where science meets fiction™

Remote control device 'controls' humans

2011-12-17T15:06:00.000-08:00

Author: Yuri Kageyama, Associated Press

ATSUGI, Japan — We wield remote controls to turn things on and off, make them advance, make them halt.
Ground-bound pilots use remotes to fly drone airplanes, soldiers to maneuver battlefield robots.

But manipulating humans?

Prepare to be remotely controlled. I was.

Just imagine being rendered the rough equivalent of a radio-controlled toy car.

Nippon Telegraph & Telephone Corp., Japans top telephone company, says it is developing the technology to perhaps make video games more realistic. But more sinister applications also come to mind.

The author leans to her left as she is remote-controlled by a technology called galvanic vestibular stimulation.
By Itsuo Inouye, AP

I can envision it being added to militaries' arsenals of so-called "non-lethal" weapons.

A special headset was placed on my cranium by my hosts during a recent demonstration at an NTT research center. It sent a very low voltage electric current from the back of my ears through my head — either from left to right or right to left, depending on which way the joystick on a remote-control was moved.
• Home Entertainment
• Digital Photography
• Consumer Goods
• Computers
• Mobile
• Software

I found the experience unnerving and exhausting: I sought to step straight ahead but kept careening from side to side. Those alternating currents literally threw me off.

The technology is called galvanic vestibular stimulation — essentially, electricity messes with the delicate nerves inside the ear that help maintain balance.

I felt a mysterious, irresistible urge to start walking to the right whenever the researcher turned the switch to the right. I was convinced — mistakenly — that this was the only way to maintain my balance.

The phenomenon is painless but dramatic. Your feet start to move before you know it. I could even remote-control myself by taking the switch into my own hands.

There's no proven-beyond-a-doubt explanation yet as to why people start veering when electricity hits their ear. But NTT researchers say they were able to make a person walk along a route in the shape of a giant pretzel using this technique.

It's a mesmerizing sensation similar to being drunk or melting into sleep under the influence of anesthesia. But it's more definitive, as though an invisible hand were reaching inside your brain.

NTT says the feature may be used in video games and amusement park rides, although there are no plans so far for a commercial product.

Some people really enjoy the experience, researchers said while acknowledging that others feel uncomfortable.

I watched a simple racing-car game demonstration on a large screen while wearing a device programmed to synchronize the curves with galvanic vestibular stimulation. It accentuated the swaying as an imaginary racing car zipped through a virtual course, making me wobbly.

Another program had the electric current timed to music. My head was pulsating against my will, getting jerked around on my neck. I became so dizzy I could barely stand. I had to turn it off.

NTT researchers suggested this may be a reflection of my lack of musical abilities. People in tune with freely expressing themselves love the sensation, they said.

"We call this a virtual dance experience although some people have mentioned it's more like a virtual drug experience," said Taro Maeda, senior research scientist at NTT. "I'm really hopeful Apple Computer will be interested in this technology to offer it in their iPod."

Research on using electricity to affect human balance has been going on around the world for some time.

James Collins, professor of biomedical engineering at Boston University, has studied using the technology to prevent the elderly from falling and to help people with an impaired sense of balance. But he also believes the effect is suited for games and other entertainment.

"I suspect they'll probably get a kick out of the illusions that can be created to give them a more total immersion experience as part of virtual reality," Collins said.

The very low level of electricity required for the effect is unlikely to cause any health damage, Collins said. Still, NTT required me to sign a consent form, saying I was trying the device at my own risk.

And risk definitely comes to mind when playing around with this technology.

Timothy Hullar, assistant professor at the Washington University School of Medicine in St. Louis, Mo., believes finding the right way to deliver an electromagnetic field to the ear at a distance could turn the technology into a weapon for situations where "killing isn't the best solution."

"This would be the most logical situation for a non-lethal weapon that presumably would make your opponent dizzy," he said via e-mail. "If you find just the right frequency, energy, duration of application, you would hope to find something that doesn't permanently injure someone but would allow you to make someone temporarily off-balance."

Indeed, a small defense contractor in Texas, Invocon Inc., is exploring whether precisely tuned electromagnetic pulses could be safely fired into people's ears to temporarily subdue them.

NTT has friendlier uses in mind.

If the sensation of movement can be captured for playback, then people can better understand what a ballet dancer or an Olympian gymnast is doing, and that could come handy in teaching such skills.

And it may also help people dodge oncoming cars or direct a rescue worker in a dark tunnel, NTT researchers say. They maintain that the point is not to control people against their will.

If you're determined to fight the suggestive orders from the electric currents by clinging to a fence or just lying on your back, you simply won't move.

But from my experience, if the currents persist, you'd probably be persuaded to follow their orders. And I didn't like that sensation. At all.

Fuente: http://www.usatoday.com/tech/products/gear/2005-10-25-remote-human-control_x.htm

Subsensory galvanic vestibular stimulation augments arterial pressure control upon head-up tilt in human subjects

2011-12-17T15:01:00.000-08:00

Subsensory galvanic vestibular stimulation augments arterial pressure control upon head-up tilt in human subjects

Kunihiko Tanakaa, Corresponding Author Contact Information, E-mail The Corresponding Author,
Chikara Abea, Yuzuru Sakaidab, Mitsuhiro Aokib, Chihiro Iwataa, Hironobu Moritaa

a Department of Physiology, Graduate School of Medicine, Gifu University, Gifu 501-1194, Japan
b Department of Otolaryngology, Graduate School of Medicine, Gifu University, Gifu 501-1194, Japan

Available online 16 November 2011.

Abstract

The vestibular system plays an important role in control of arterial pressure (AP) upon head-up tilt (HUT).

To examine this role in human subjects, we previously compared changes in AP with and without high-amplitude galvanic vestibular stimulation (GVS), which is considered to obscure vestibular input.

In contrast, regarding sensory function in skin and muscle, it has been documented that low-amplitude electrical stimulation improves both sensitivity and response.

In the present study, we examined whether GVS of smaller amplitude improves AP control upon HUT.

GVS was applied:

at the amplitude of the somatosensory threshold (0.3–0.8 mA),
0.1 mA over the threshold, and
0.1 and 0.2 mA below the threshold during HUT.

AP decreased at the onset of HUT compared with that in the supine position in 15 of 25 subjects without GVS (− 12 ± 2 mm Hg), but applying GVS at 0.1 mA below the somatosensory threshold diminished the decrease (0.3 ± 0.7 mm Hg).

The APs of another 10 subjects were maintained or decreased by less than 5 mm Hg without GVS at the onset of HUT (4 ± 2 mm Hg), but applying GVS at the amplitude of 0.1 mA below the somatosensory threshold further increased the AP (12 ± 2 mm Hg).

GVS at the other amplitudes did not result in AP changes in either group.

Thus, subsensory weak GVS enhances AP control at the onset of HUT.

Keywords: Vestibulocardiovascular reflex; Stochastic resonance; Subjective visual ertical; Caloric test

Corresponding Author Contact Information
Corresponding author at:
Department of Physiology, Graduate School of Medicine,
Gifu University, Gifu 501-1194,
Japan.
Tel.: + 81 58 230 6300; fax: + 81 58 230 6302.

Fuente: Autonomic Neuroscience
Volume 166, Issues 1-2, 26 January 2012, Pages 66-71

Acufenos y Anemia

2011-12-15T19:03:00.000-08:00

Hasta 25% de mexicanos con anemia, afirman

Eduardo Reynoso, titular del Centro Especializado en Enfermedades Hematológicas Malignas del Hospital Español, dijo que se presenta sobre todo en mujeres en edad reproductiva y niños menores de cinco años
San Diego | Domingo 11 de diciembre de 2011 Notimex | El Universal

Hasta 25% de la población en México padece algún grado de anemia o tiene deficiencia de hierro, pero afecta sobre todo a las mujeres en edad reproductiva y a menores de cinco año, informó el especialista Eduardo Reynoso Gómez.

En el 53 Congreso Mundial de la Asociación Americana de Hematología, el titular del Centro Especializado en Enfermedades Hematológicas Malignas del Hospital Español dijo que la anemia en los menores los limita en su adecuado crecimiento y desarrollo físico y mental.

De acuerdo con estudios del Instituto Nacional de Nutrición y Ciencias Médicas Salvador Zubirán de la Secretaría de Salud, hasta 25 por ciento de la población mexicana tiene, si no anemia, sí deficiencia de hierro, puntualizó.

Explicó que esa situación se presenta en mujeres en la etapa más productiva de la vida por pérdida de sangre debido a la menstruación, lo que provoca reducción de hierro, sustancia que se concentra 98% de la sangre.

Indicó que el hierro, aunque es parte de nuestro organismo y vital para la composición de la sangre, los seres humanos no estamos diseñados para asimilarlo, al igual que el plomo y el mercurio.

Sin embargo, tenemos un gen que ayuda a que lo aprovechemos, mas si por cualquier motivo falta dicho gen, se produce una enfermedad que se llama macromatosis, y el hierro empieza a absorberse de manera indiscriminada, lo que produce intoxicación y muerte.

El también experto en oncología recomendó consumo complementario de hierro en las edades de cero a cinco años, y en mujeres de la adolescencia a la menopausia, pero advirtió que no se debe de abusar para evitar intoxicaciones y descompensaciones por la presencia de este metal pesado.

La sangre es un tejido que está en todo nuestro organismo y es un blanco fácil de agresiones de diversos tipos, mencionó.

La anemia se debe a centenares de razones, y aunque nunca una anemia se convierte en leucemia, sí puede ser un síntoma que indique la presencia de síndrome mielodisplásico u otra enfermedad maligna.

"Es como no tener gasolina el cuerpo, las anemias como tales no provocan leucemia; algunas anemias de los síndromes mielodisplasicos, se reportan porque hay caídas en las cuentas de la hemoglobina, lo que puede ser manifestación de un trastorno más grave", explicó.

La anemia tiene manifestaciones muy específicas, generalmente cuando disminuye la capacidad de la sangre para transportar oxígeno, la gente se percibe más fatigada y cualquier esfuerzo físico produce una sensación de haber hecho tres a cinco veces más esfuerzo.

"La gente se siente muy fatigada, se ve pálida, en ocasiones cuando la sangre disminuye mucho su contenido celular produce fenómenos físicos y las personas escuchan zumbidos y que les bombea más rápido el corazón", indicó.

La deficiencia de hierro es la causa prevalente de anemia, produce síntomas peculiares, como cuando las embarazadas se comen las paredes, tierra mojada, mastican hielo, en fin, un sin número de necesidades imperiosas.

"Hay gente que se come las revistas y las huelen, como una droga, también lo hacen con jabón de lavar con gasolina o alcohol; se les denomina síntomas piques y son manifestaciones de anemia de algunos tipos", aseveró.

El experto explicó las enfermedades hematológicas malignas que se analizan en ese Congreso Mundial, como los linfomas de Hodgkin y de No Hodgkin (LNH) , el Mieloma Múltiple (MM) , las leucemias agudas y crónicas y los síndromes mielodisplásicos.

Indicó que los cánceres se dividen en tumores sólidos y neoplasias hematológicas que es lo que se conocen como los "cánceres líquidos" en la sangre.

Señaló que a diferencia de Europa y Estados Unidos, en México las de más alta prevalencia son las leucemias, normalmente las leucemias agudas, el mieloma y los linfomas van aumentando conforme aumenta la edad de las personas.

Fuente: http://www.eluniversal.com.mx/notas/815494.html

Estudios sobre acúfenos e hiperacusia en Sevilla y controversia

2011-12-15T18:52:00.000-08:00

jueves 15 de diciembre de 2011
Acúfenos (pitidos) y SSC???!!!

Apreciados/as amigos/as, nuevamente, nos vemos en la obligación de denunciar lo que desde un Hospital de Sevilla, El Virgen del Rocio, el Dr Miguel Ángel López González pretende llevar a cabo: un estudio sobre los acúfenos (pitidos) en pacientes de SSC (FM, SFC, SQM) para lo cual se deberán rellenar ciertos cuestionarios mediante la ayuda de un experto de la psicosociología.

La FM, el SFC y el SQM, son tratadas como síntomas junto a los acúfenos o tinnitus (ruidos) o la hiperacusia (o la tolerancia a un humbral de ruido considerado normal).

Nuevamente patologias graves de origen neuro-inmuno-infecciso se intentan explicar mediante las "psicociencias", nuevamente se gastan dineros públicos en investigaciones que no nos sirven para nada -mientras que las realmente importantes se tapan- sino todo lo contrario, nuevamente se buscan rasgos de personalidad en pacientes diagnosticados de fibromialgia, la denostada "personalidad fibromiálgica", nuevamente, y sólo pasa con los SSC, cada vez que se habla de publicar algo, los pacientes nos echamos a temblar.

¿Hasta cuando?

Aquí os dejamos la relación de correos de Clara Valverde, Jose Luis Rivas y por último un magnífico escrito de Paula Carracelas que llama a la reflexión y a la lucha.

Os pedimos disculpas por la extensión de la presente entrada, pero os recomendamos, aunque sea poquitos, irlas leyendo.

Un tremendo saludo!
Equipo ASSSEM

Primer correo del Dr López a todas las asociaciones:

Estimados Asociados

La Unidad de Estudio e Investigación de Acúfenos e Hiperacusia del Hospital Universitario Virgen del Rocío de Sevilla está llevando a cabo un estudio sobre el Síndrome de Sensibilidad Central que engloba los síntomas de fibromialgia, fatiga crónica, SSQM, acúfenos. hiperacusia, etc. Este estudio considera a estos procesos como síntomas y no como enfermedades (oficialmente se consideran a estos síntomas como enfermedades).

El capítulo 42 del libro titulado "Acúfeno como Señal de Malestar" detalla este punto de vista. Este libro puede conseguirse en PDF de la página web: www.saeia.es en su apartado de publicaciones. Puede bajarse gratuitamente. Tiene licencia Creative Commons.

El Estudio abarca a pacientes diagnosticados de fibromialgia. Consta de tres fases. Fase 1, los pacientes rellenarán dos cuestionarios. Fase 2, los pacientes realizarán una entrevista psicosocial realizada por un doctor en sociología experto en psicosociología a la cual tendrán que acudir con un allegado. Fase 3, tratamiento psicosocial.

La Fase 1 puede realizarse desde su localidad de residencia. La Fase 2 que es la entrevista, se realizará en el Hospital Virgen del Rocío de Sevilla y la Fase 3 se realizaría en su localidad de residencia.

Si los pacientes diagnosticados de fibromialgia desean participar, deben rellenar los dos cuestionarios anónimos (se adjuntan en un mismo archivo) que enviarán una vez rellenos a la dirección de e-mail de abajo. Cuando se concluya la Fase 1, los resultados estarán a disposición de los participantes. Los resultados de la Fase 1 se expondrán en una Reunión de Expertos que se celebrará en Sevilla en la primavera-2012. Concluida la Fase 1, se pasaría a la Fase 2.
Para cualquier información, aclaración o duda, se pueden poner en contacto en la misma dirección de e-mail de abajo.

Atentamente

Doctor Miguel A. López González
Profesor Asociado de ORL
UGC Otorrinolaringología
Hospital Universitario Virgen del Rocío
Sevilla
España
malopez@cica.es

Respuesta 1 de Clara Valverde:

Suponemos que el fallo en el enfoque de este estudio es debido a una falta de información por su parte. Los acúfenos y la hipercusia no son Síndromes de Sensibilidad Central. Usted no se puede inventar categorías. Los Sindrome de Sensibildad Central definidos por Yunus (2004) son el Síndrome de la Fatiga Crónica/Encefamielitis Miálgica, Fibromialgia, Sensibilidades Químicas Centrales, Síndrome de la Guerra del Golvo (GWS) y Electrosensibilidades (EH). Los acúfenos y la hipercusia son posibles síntomas de los SSC.

El cuestionario sobre la personalidad de la persona con fibromialgia que usted adjunta es, en el caso de una enfermedad organica neuroquímica, irrelevante y hace dudar de su profesionalidad. Y aún más cuando se dice que la persona con fibromialgia tendrá que acudir a la entrevista "con un allegado".

Le animamos a estudiar la reciente literatura científica sobre los SSC y de enfocar sus investigaciones en otras áreas en las cuales posiblemente usted sea más conocedor. También le animamos a dejar de desinformar a las personas que ya tienen suficiente con vivir con unas enfermedades tan discapacitantes. Sus ideas y las de su equipo sobre los aspectos psicosociales de la fibromialgia pueden ser un terreno que le va a causar problemas y podrían ponerle en ridículo en la comunidad médico-científica.

Nuestra asociación ASSSEM de profesionales sanitarios dedicados a los SSC www.asssem.org le puede ayudar a estar informado sobre los SSC. Nuestro equipo de médicos, enfermeros, farmacéuticos y expertos en comunicación, nos dedicamos a asegurarnos de que los profesionales sanitarios estén al día de las publicaciones e investigaciones.

Lo que hemos visto de su estudio es, seguramente sin malas intenciones, una acción que promueve la desinformación.

Pero, como verá por la respuesta que va a tener, los enfermos de SSC en España ya están bastante informados y ya no aceptan estudios sobre su "personalidad".

EStamos a su disposición.

Saludos,
Clara Valverde, profesora de enfermería,
Relaciones Internacionales ASSSEM www.asssem.org
Presidenta Liga SFC www.ligasfc.org

P.D. Le adjuntamos un manual para profesionales sanitarios sobre los SSC.

Respuesta 1 del Dr López:

Estimada Profesora Clara Valverde

Gracias por sus comentarios. El enfoque que quiero darle al estudio es para poder demostrar científicamente que hay muchos más síntomas dentro del espectro del SSC. Como usted bien dice, en la actualidad los acúfenos y la hiperacusia están considerados como posibles síntomas del SSC. Cuando tengamos los resultados de la Fase 1 se expondrán en una Reunión Internacional de Expertos en 2012 para poder recibir los comentarios, críticas y consejos, que realmente son los que ayudan en las investigaciones.

Reitero mi agradecimiento por sus críticas, comentarios y consejos.

Atentamente

Doctor Miguel A. López González
Unidad de Estudio e Investigación de Acúfenos e Hiperacusia
Profesor Asociado de ORL
UGC Otorrinolaringología
Hospital Universitario Virgen del Rocío
Sevilla
España
malopez@cica.es

Respuesta 2 de Clara Valverde:

Estimado Dr Gómez,

No entendemos por qué quieren demostrar "que hay muchos más síntomas" cuando en la descripción de los 5 SSC hay cientos de síntomas, incluyendo los acúfenos y la hiperacusia. Supongo que está familarizado con la investigación de gran importancia del Dr James Baraniuk de la Universidad de Georgetown, investigación que hizo a través de los NIH, sobre los síntomas como el tinitus, etc, en los SSC que él descubrió que son debidos a las proteinas dobladas en el líquido cefalorraquídio. El Dr Joaquim Mullol, otorrino del Hospital Clinic de Barcelona organizó confencias con Baraniuk en España hace pocos años.

Y tampoco no entendemos por qué hacen un cuestionario sobre la personalidad del paciente si ustedes piensan que la fibromialgia es una enfermedad orgánica.
Nos han contactado (a ASSSEM) varias asociaciones que han recibido su cuestionario para preguntarnos sobre este punto en particular y esperan una respuesta.
Nosotros también.

Saludos,
Clara Valverde

A partir de aquí sólo podemos copiar las réplicas de Clara (ella nos ha dado autorización para ello) pero no las del Dr López, ya que podríamos incurrir en falta administrativa.

No obstante, os haremos unos apuntes de sus respuestas para no perder el hilo.

Apuntes de la Respuesta 2 del Dr Gomez:

Comenta que el cuestionario indica los rasgos de personalidad de los pacientes de FM. Dice que los estudios previos les han dado patrones de personalidad muy definidos. Extrapola estos estudios a pacientes con cefaleas, con resultados positivos y/o tratamientos.
Concluye con que con estos estudios sólo se pretender dar otro punto de vista que deberá de valorar la comunidad científica.

Respuesta 3 de Clara Valverde:

Estimado Dr Gómez,

Los profesionales que llevamos años implicados en los SSC y los pacientes de España, estamos hartos de la psicologicación de los SSC, y sobre todo la insultante categoría inventada de "la personalidad fibromiálgica". Esta idea tan poco científica ha sido denunciada en numerosas ocasiones y hasta es parte de la macro-demanda que se va a llevar a cabo en Catalunya contra el Departament de Sanitat por no atender correctamente los SSC. Obviamente si se piensa que hay una "personalidad fibromiálgica" no se puede atender correctamente a esa enfermedad orgánica. Lo mismo pasaría si usted decidiera que hay una "personalidad farnigítica".

VEmos que su investigación es muy poco seria y que ustedes no se han hecho una revisión bibliográfica de las investigaciones de los últimos 10 años ni en su especialidad ni en neurología. Por eso compartimos esta información con profesionales sanitarios y asociaciones de afectados de Andalucía para que ellos puedan proceder a denunciarle como es debido.

Lo que es un poco sorprendente es que usted esté dispuesto a poner su carrera en juego ante profesionales sanitarios, otorrinos, pneumólogos e internistas españoles que piensan que el concepto de la "personalidad fibromiálgica" es un error ya sobre pasado hace muchos años.

Sinceramente,
Clara Valverde

Respuesta 1 de José Luis Rivas (sin contestación):

Apreciado Dr López,
tal y como le comentaba Clara Valverde, es poco riguroso el intentar relacionar patologías orgánicas como la FM o el SFC con rasgos diferenciales de la personalidad, como pretenden hacer desde su unidad hospitalaria hispalense.

No es que rehusemos la ayuda de profesionales de la salud que intentan correlacionar diferentes variables con los SSC, sino que vemos en otros perfiles más próximos a la inmunología, virología u oncología bastante más útilidad. El seguir insistiendo en lo "psiconosequé" no hace más que perjudicarnos seriamente como colectivo de afectados.

Recientemente un grupo formado por retrovirologos y expertos inmunólogos del centro de excelencia de la lucha contra el SIDA, IrsiCaixa de Can Ruti, Badalona, Barcelona, detectaba alteraciones inmunes graves y características en un pequeño grupo de estos enfermos. Desde la asociación de sanitarios la cual presido, ASSSEM, hemos valorado como enormente positivo ampliar dicho estudio para dilucidar si estos parámetros se reproducen en mayor escala y correlacionar nuestras patologías con biomarcadores a fin de "salir del pozo" de la especulación y de las psicociencias, si me lo permite.

También recientemente, un grupo de oncólogos noruego de un pequeño hospital noruego, curaba 2 de cada 3 pacientes con SFC-EM a los que se les infundía el Rituximab, un fármaco que actúa provocando la deplección específica de los linfocitos CD20 en el tratamiento del Linfoma de no Hodking's.

¿Digame, de qué manera la personalidad fibromiálgica o los acúfenos podrían interferir de manera evidente en estos dos hechos que acabo de mencionar?

Es sólo un consejo, pero pensamos que no está siguiendo un camino adecuado, y de sabios es rectificar.

Disculpe, no obstante la franqueza,

Un atento saludo,
JoseL Rivas
Dr en Farmacia y Presidente de ASSSEM
www.assssem.org

Respuesta 1 de Paula Carracelas (sin contestación)

Como profesional de las ciencias de comunicación no puedo pronunciarme desde el punto de vista de la ciencia médica, pero si desde la experiencia propia, el estudio de documentación y el razonamiento lógico. Así pues, ya que usted nos invita a los enfermos a participar en su estudio, permítame que yo le invite a hacer la siguiente reflexión, para que entienda el posicionamiento de los enfermos de SSC respecto al enfoque tradicional de la psicología al abordar estas enfermedades y cuál es el error de base que hace que estos estudios no hagan más que perpetuar este lamentable error asistencial que tristemente está llamado a llenar una de las páginas negras en la historia de la medicina.

Y para hacer esta reflexión, partamos de la siguiente historia, que sin duda le sonará a ciencia ficción:

Olvidémonos por un momento de los enfermos de SSC e imagine el siguiente supuesto: Coja un número considerable de enfermos por ejemplo de cáncer. Desde que empiecen a referir sintomatología, como dolor y cansancio, retrase su diagnóstico un promedio de cuatro años; mientras tanto derívelos a todo tipo de especialistas, en función de cada síntoma; pero no realice ningún enfoque global de la sintomatología y no los derive a oncología. Cuando hayan sido diagnosticados, por cualquier especialista, invíteles a paliar su dolor recurriendo al “pensamiento positivo” y sobre todo responsabilícelos de su estado de salud y deterioro por no llevar un adecuado ritmo de vida, culpabilizándolos tanto si llevan un ritmo activo como si lo llevan pausado. A los menos activos, dígales que lo que necesitan para curarse es llenar su tiempo con actividades para no pensar tanto; y a los que estén más activos, dígales que para mejorar tienen que parar y reducir su actividad al mínimo; pero bajo ningún concepto les den facilidad para ejecutar esta recomendación, obligándolos por tanto a mantener su jornada laboral si quieren tener dinero para subsistir, o castigándolos con la indigencia si quieren seguir el consejo para encontrarse mejor de salud.

Mientras tanto, niégueles cualquier prueba que pueda objetivar su enfermedad y sirva para determinar su naturaleza orgánica, haciendo ver a la sociedad en general que su enfermedad no es real y lanzando a la opinión pública toda clase de calificativos que nieguen la realidad del padecimiento de estos enfermos, como que son unos cuentistas, unos vagos o que si algo tienen es una depresión. Mantenga esta situación al menos seis años más, ofreciendo a los enfermos visita médica cada dos años, pero sólo para darles fármacos que, aunque sabe no le van a servir para nada, le permita justificar frente al enfermo que ya está siendo tratado; al mismo tiempo, continúe instándole a pensar en positivo si quiere mejorar de su enfermedad y asegúrese de que sus colegas de la profesión médica los traten de maniáticos cuando los tengan delante.

Cuando haya terminado el experimento, empiece a realizar un estudio psicológico sobre estos enfermos, sabiendo que han compartido la misma experiencia traumática durante los últimos diez años. Busque parámetros comunes, ¡seguro que los encuentra!, es imposible que no coincidan en nada, pues al menos todos compartirán el sentimiento de que están hartos de que les tomen el pelo. Cuando encuentre esos parámetros comunes, analícelos pero sin tener en cuenta el experimento, como si no hubiera existido, y utilícelos para elaborar un perfil cancerígeno con el que poder justificar que el origen del cáncer es psicológico y utilizarlo para seguir manteniendo vivo el experimento con la idea de que no tenga fin.

¿Ve usted en esta historia hipotética que le cuento algún fundamento científico para poder afirmar que al final, todo el experimento, se ha hecho por el bien de los enfermos?

Además de no tener fundamento científico, ¿no le parece que la historia incluso suena perversa?

Lo que nos permite a los enfermos de SSC contarle esta historia en paralelo con otras enfermedades orgánicas, como puede ser el cáncer, es que afortunadamente ya existe evidencia científica respecto a las graves alteraciones inmunológicas que presentan los enfermos de SSC. Estando legitimado pues que hagamos este paralelismo en la historia que acabo de contarle y tomando ésta como referencia, yo le preguntaría ¿tiene usted alguna evidencia que le de sentido científico al hecho de que busque un perfil psicológico en enfermos orgánicos, independientemente y al margen del hecho de que hayan compartido la misma experiencia traumática a nivel asistencial, jurídico y social?

Espero que esto le ayude a reflexionar.

Atentamente
Paula Carracelas

Fuente: http://www.asssem.org/2011/12/acufenos-pitidos-y-ssc.html#comment-form
Publicado por Dori Fernández en 12/15/2011 12:39:00 AM
Enviar por correo electrónicoEscribe un blogCompartir con TwitterCompartir con Facebook
Etiquetas: Denuncia, Investigación, La sanidad a juicio, Sanidad publica, Síndrome de Sensibilidad Central
Reacciones:
1 comentarios:

MIRIAM dijo...

Dori gracias por explicarlo tan bien!!!!
Esa es un radiografía exacta de lo que pasamos y a lo que estamos sometidos por padecer estas enfermedades,
gracias
15 de diciembre de 2011 16:23

Fuente: http://afaramos.blogspot.com/2011/12/acufenos-pitidos-y-ssc.html
Nota de la redacción: es interesante comprobar como impactan distinto los puntos de vista de investigadores muy acreditados como el Prof.Dr. Miguel Angel Lopez y de pacientes y personas interesadas en la tematica de acufenos e hiperacusia.

la Organización de Caridad Británica BTA lanza un foro de acúfenos para Profesionales

2011-12-10T13:04:00.000-08:00

(PRWEB Reino Unido)
08 de diciembre 2011

La Asociacion Tinnitus Association (BTA), la única de caridad del Reino Unido dedicada a apoyar a los que sufren tinnitus, ha puesto en marcha un foro en línea dedicado a los profesionales que trabajan en el SNS que tratan a las personas con tinnitus.

Como la autoridad principal del Reino Unido sobre el tinnitus, el foro es una extensión de nuestros servicios existentes para los profesionales.

Nos esforzamos por ofrecer una amplia gama de información y recursos que permitan a quienes consultan los pacientes de tinnitus.

El foro, que se celebrará en el sitio web del British Tinnitus Association, ha sido creado en respuesta a las peticiones de muchos de los que trabajan en el campo.

Se identificó la necesidad de proporcionar a los profesionales un espacio donde pueden compartir ideas, mejores prácticas y discutir los desafíos que enfrentan en el campo.

La BTA ya ofrece gran cantidad de recursos para los profesionales, incluida la Formación Profesional para Asesor en tinnitus, una conferencia anual, una amplia gama de publicaciones gratuitas y actualizaciones sobre la investigación del tinnitus.

Muchos de estos están disponibles de forma gratuita en el sitio web de la BTA.
El foro ha sido creado para ofrecer un único recurso confidencial, tinnitus se centró en los profesionales que trabajan en el NHS.

Para acceder al nuevo foro, los profesionales deben registrarse primero en el http://www.tinnitus.org.uk página web y luego participar en el foro en http://www.tinnitus.org.uk/forums/5.

David Stockdale, director ejecutivo de la Asociación Británica de Tinnitus, dijo: "Como primera autoridad del Reino Unido sobre el tinnitus, el foro es una extensión de nuestros servicios existentes para los profesionales.

Nos esforzamos por ofrecer una amplia gama de información y recursos que permitan a los pacientes que consultan tinnitus están tan bien informados acerca de la condición como sea posible. "

Siendo que no es una enfermedad o dolencia, el tinnitus es un término que describe la sensación de oír un ruido en la ausencia de un sonido externo.

El ruido puede tener prácticamente cualquier calidad. Zumbido, silbidos y zumbidos son comunes, pero los que suenan más complejos también pueden ser referidos.

El tinnitus Problemático puede ser muy angustiante para la persona afectada, y pueden surgir problemas con el sueño, la concentración y el estado de ánimo.

Sin embargo, en muchos casos, los cambios sutiles en el ambiente de la gente puede resolver estos problemas, y mejorar la calidad de vida.

La BTA se creó como una organización independiente en 1991 y ahora es compatible con miles de pacientes de tinnitus y aconseja a los profesionales médicos de todo el mundo.

La British Tinnitus Association se esfuerza por ser la principal fuente de apoyo e información para las personas con tinnitus en el Reino Unido, facilitando así una mejor calidad de vida.

Su objetivo es fomentar la prevención a través de su programa educativo y de buscar una cura para el ruido en la cabeza permanente a través de un programa de investigación médica.

El experimentado equipo de la BTA comprende el impacto que el tinnitus puede tener en la vida de los enfermos y los que viven con ellos, por lo que ofrece el asesoramiento más adecuado y de expertos y la información de forma gratuita - a través de una línea de ayuda gratuita en 0800 018 0527 y en línea en http://www.tinnitus.org.uk.

La BTA también ofrece información impresa y soporte de audio por correo postal.

Para obtener más información:

Contacto: Zoe Hiljemark, PR Director de Cuentas / Jenny Pearce, Ejecutivo Senior de Cuenta PR

E-mail: zoe (a) la comercialización, asuntos (punto) co (punto) Reino Unido / jenny (a) la comercialización, asuntos (punto) co (punto) del Reino Unido
Tel: +44 (0) 1202 777111 / +44 (0) 7770 924439

Dirección: Cuestiones de Marketing de la Unidad C, Acorn Business Park, Ling Road, Poole, Dorset, Reino Unido, BH12 4NZ
# # #
Compartir:

Contacto
Jenny Pearce
Cuestiones de marketing - Reino Unido
01202777111
E-mail

PRWeb Inicio
Centro de Noticias
Estamos aquí para ayudar.
Llame al 1-866-640-6397

Charity Launches Tinnitus Forum for Professionals

The British Tinnitus Association (BTA), the only UK charity dedicated to supporting those who experience tinnitus, has launched a dedicated online forum for professionals working in the NHS who treat people with tinnitus.

As the UK’s leading authority on tinnitus, the forum is a further extension to our existing services for professionals.

We endeavour to offer a comprehensive range of information and resources to enable those consulting tinnitus patients.
(PRWEB UK) 8 December 2011

The forum, which will be hosted on the British Tinnitus Association’s website, has been created in response to many requests from those working in the field.

A need was identified to provide professionals with a space where they can share ideas, best practice and discuss the challenges faced in the field.

The BTA already offers extensive resources for professionals, including Tinnitus Adviser Training, an Annual Conference, an extensive range of free publications and updates on tinnitus research.

Many of these are available free of charge on the BTA website.
The forum has been created to provide a unique, confidential, tinnitus focussed resource for professionals working in the NHS.

To access the new forum, professionals must first register on the website http://www.tinnitus.org.uk and then join the forum at http://www.tinnitus.org.uk/forums/5.

David Stockdale, CEO of the British Tinnitus Association, said: “As the UK’s leading authority on tinnitus, the forum is a further extension to our existing services for professionals.

We endeavour to offer a comprehensive range of information and resources to enable those consulting tinnitus patients are as well informed about the condition as possible.”

Not an illness or disease, tinnitus is a term that describes the sensation of hearing a noise in the absence of an external sound.

The noise can have virtually any quality. Ringing, whistling, and buzzing are common, but more complex sounds may also be reported.

Troublesome tinnitus can be very distressing for the affected individual, and issues may arise with sleep, concentration and mood. However, in many cases, subtle changes in people’s environment can address these issues, and improve quality of life.

The BTA was set up as an independent charity in 1991 and now supports thousands of tinnitus sufferers and advises medical professionals from across the world.

The British Tinnitus Association strives to be the primary source of support and information for people with tinnitus in the UK, thereby facilitating an improved quality of life.

It aims to encourage prevention through its educational programme and to seek a cure for permanent head noise through a medical research programme.

The experienced team at the BTA understands the impact that tinnitus can have on the lives of sufferers and those who live with them, so provides the most appropriate and expert advice and information free of charge – via a free helpline on 0800 018 0527 and online at http://www.tinnitus.org.uk.

The BTA also offers printed information and audio support via post.

For more information
Contact: Zoe Hiljemark, PR Account Director / Jenny Pearce, Senior PR Account Executive

E-mail: zoe(at)marketing-matters(dot)co(dot)uk / jenny(at)marketing-matters(dot)co(dot)uk
Tel: +44 (0) 1202 777111 / +44 (0) 7770 924439

Address: Marketing Matters, Unit C, Acorn Business Park, Ling Road, Poole, Dorset, UK, BH12 4NZ
###
Share:

Contact
Jenny Pearce
Marketing Matters - UK
01202777111
Email

PRWeb Home
News Center
We're here to help.
Call 1-866-640-6397

El SAS pagará 30.000 euros a un paciente

2011-12-01T19:29:00.000-08:00

Tras no fiarse del diagnóstico público, el demandante fue operado con éxito en una clínica privada en Granada
29.11.2011 - 01:00

El juzgado de lo contencioso administrativo número 1 de Sevilla ha estimado la demanda del almeriense E.H.M, de 45 años de edad, en la que condena al Servicio Andaluz de Salud (SAS) y a su aseguradora a indeminizarlo con 35.000 euros por no haberle detectado un tumor cerebral en su momento y del que tuvo que ser intervenido por un especialista privado después de acudir a un centro de salud.

La historia de este suceso radica en el año 2006, cuando el demandante empezó a sufrir a sufrir pérdida de equilibrio, mareos, acúfenos y sensación de que los objetos se movían, por lo que acudió sin demora a su médico de cabecera a su centro de salud, quien lo derivó al otorrinolaringología (ORL) con un pase preferente. Sin embargo, el otorrino le diagnosticó, sin pruebas clínicas, otosclerosis.

Ante la gravedad de los síntomas y guiado por su intuición, el paciente decidió ir a una clínica privada en Granada, donde con una simple resonancia magnética le diagnostican en abril de 2005 un tumor cerebral, del que fue intervenido quirúrgicamente. Operación de la que le quedaron secuelas como pérdida de audición en un oído, problemas en un ojo y parálisis facial.

Poco tiempo después de la operación, el demandante acudió a la Asociación el Defensor del Paciente y fue derivado al abogado Ignacio Martínez. En mayo de 2006 presentaron reclamación patrimonial ante el SAS que fue desestimada en 2009. Contra dicha desestimación expresa se interpuso demanda ante el juzgado contencioso administrativo de Sevilla, que finalmente le terminó dando la razón al demandante.

Fuente: elalmeria.es
Nota de la redacción: los estudios de radiologia como la Resonancia Magnetica Nuclear permiten el diagnostico precoz y el tratamiento de los tumores cerebrales que pueden provocar síntomas auditivos y del equilibrio, estos tumores son estadisticamente escasos, generalmente beningnos, pero deben ser sospechados, diagnosticados y tratados en tiempo y forma.

El SAS pagará 30.000 euros a un paciente

2011-12-01T19:24:00.000-08:00

Cognitive and behavioural effects of physical exercise in psychiatric patients

2011-12-01T19:11:00.000-08:00

Fuente de la imagen: http://trialx.com/curetalk/2011/09/

Authors
Christian Knöchel Corresponding Author Contact Information, E-mail The Corresponding Author, Viola Oertel-Knöchel, Laurence O’Dwyer, David Prvulovic, Gilberto Alves, Bianca Kollmann, Harald Hampel

Department of Psychiatry, Psychosomatic Medicine and Psychotherapy, University of Frankfurt/Main, Heinrich Hoffmann Str. 12, 60528 Frankfurt, Germany

Available online 24 November 2011.

Abstract

The current review outlines the under-appreciated effects of physical exercise on the course of psychiatric disorders, focussing on recent findings from animal and human research. Several studies have shown that regular physical exercise is significantly beneficial for psychiatric patients both on a biological and a psychological level. Positive effects of controlled exercise include improved metabolic responses, neuro-protection, increased quality of life, and reduced psychopathological symptoms.

Studies investigating the effectiveness of various physical training interventions in alleviating severe mental diseases, such as Alzheimer's dementia (AD), schizophrenia (SZ) or major depressive disorder (MDD) indicate that physical exercise can relieve symptoms of depression, psychosis and dementia and more importantly can curtail further progression of these diseases. This review assesses the most effective methods of physical training for specific psychiatric symptoms.

Introducing physical exercise in therapeutic regimes would be an innovative approach that could significantly reduce the severity of psychopathological and cognitive symptoms in patients. The positive biological and molecular outcomes associated with physical exercise render it a concrete therapeutic strategy for improving the quality of live and reducing physical illness in psychiatric patients. Therefore, integrating physical activity into a patient's social life may be an effective treatment strategy. Furthermore, exercise might have the potential to be a preventative treatment within the context of multi-modal therapeutic programs.
Highlights

► Under-appreciated effects of physical exercise on the course of psychiatric disorders. ► Effectiveness of various physical training interventions in alleviating severe mental diseases. ► Current studies indicate that physical exercise can relieve symptoms of depression, psychosis and dementia and curtail further progression of these diseases. ► Introducing physical exercise in therapeutic regimes would be an innovative approach.

Fuente: Progress in Neurobiology
doi:10.1016/j.pneurobio.2011.11.007
Cognitive and behavioural effects of physical exercise in psychiatric patients

Dr. Cormillot | Acúfenos o tinnitus: el zumbido en los oídos

2011-11-29T21:16:00.000-08:00

Fuente: http://comocurarelacufenorapidamente.com/dr-cormillot-acufenos-o-tinnitus-el-zumbido-en-los-oidos/

La foto-terapia Láser

2011-11-29T20:57:00.000-08:00

La foto-terapia Láser se muestra como una excelente técnica en el tratamiento de Vértigos, Acúfenos o Tinnitus, hiperacusia, aumento y recuperación de la capacidad auditiva en hipoacusias neurosensoriales, etc...

¿Qué es la Foto-Terapia láser?

La foto-terapia láser es una técnica efectiva para el tratamiento de lesiones músculo-esqueléticas, artritis y otras dolencias en diferentes condiciones, utilizando luz monocromática en la región visible, entre el casi infrarrojo al ultravioleta, del espectro electromagnético y no solo por láseres convencionales, sino también por los nuevos emisores de luz láser LED.

Sorprende que la "bio-estimulación del láser" no siempre ha sido bien comprendida, y habitualmente hasta ahora, solamente admitida para tratamientos superficiales dermatológicos, cosméticos o estéticos.

Sin embargo existen muchas posibilidades de emplear las propiedades de la "bio-estimulación celular" en otras partes y órganos del cuerpo humano y entre muchas de ellas, especificamente también en el tratamiento de diversos trastornos de las estructuras del oído interno o cóclea.

Desde nuestra experiencia, la terapia láser para la estimulación celular del oído interno presenta actualmente los mejores resultados terapéuticos, en pacientes con vértigos, acúfenos o tinnitus, hiperacusia, sordera súbita, hipoacusias neurosensoriales y otros..., con mejorías completas e incluso remisión total en ciertos casos o con mejorías parciales.

La foto-terapia es la técnica de exponer o irradiar a algún órgano o parte del cuerpo, con una luz láser de potencia suficiente, capaz de provocar el esperado y ya conocido efecto foto-biológico a nivel celular.

La regeneración de las funciones celulares, en el caso del oído interno, es un fenómeno que se produce por un efecto foto-biológico que sucede en el metabolismo celular, al exponerlas a una irradiación de luz (energía) tipo láser.

El efecto foto-biológico

Se ha demostrado que celularmente se produce un efecto foto-biológico, cuando las células son irradiadas con la adecuada energía de una fuente de luz Láser.

Las respuestas biológicas de una misma célula son dependientes al tipo de Láser, a su longitud de onda, intensidad media, dosis de fluencia, luz continua o pulsada, etc...

Un elemento de las células, conocido y denominado mitocondria, se ha mostrado como un organelo fundamental para producir el mecanismo fotobiológico y universal de activación celular. Este mecanismo no ocurre, en cambio, en células que no contienen mitocondrias y que realizan su ciclo energético por glucólisis.

¿Qué riesgos tiene el láser?

La garantía y seguridad del tratamiento nos permite asegurar que:

1. El tratamiento es totalmente indoloro, sin molestias.

2. No existen efectos adversos ni contraindicaciones. No hay registrado ningún caso con daños accidentales o irreversibles, en los diez ultimos años. El láser apliacado es médicamente SEGURO y SIN RIESGOS.

3. Hay un alto grado de evoluciones positivas en todos los pacientes tratados. Algunos trastornos crónicos requieren mayor número de dosis (sesiones), aunque no siempre se puede pronosticar un progreso positivo o mejora suficiente en algunos casos.

Algunas evidencias científicasATP

El efecto térmico del láser no explica los fenómenos biológicos de la foto-terapia.
El descubrimiento de la característica "foto-receptora" de la enzima citocromo c oxidasa, puede explicar muchos de los fenómenos de recuperación celular observados con la foto-terapia.

Estudios han demostrado, que no existen efectos adversos con exposiciones de altas dosis de láser. Más aún, los autores han comprobado que se reduce el daño proteínico ante ciertos oxidantes químicos - farmacológicos.

El papel que desempeña la molécula ATP, resulta fundamental en la activación de los mecanismos bioquímicos de regeneración celular.

La regeneración celular es un mecanismo que es activado por la exposición a una luz láser.

La regeneración supone recuperar funciones perdidas o normalizar los procesos del metabolismo celular que estuviesen alterados.

Fuente: Otoclinica-centro Médico de Terapias Auditivas
http://www.otoclinica.es/noticia_ampliada.php?id_noticia=97
Pd. nuestro agradecimiento por su informacion sobre la FotoTerapia Laser al Dr.Dr. Tarsicio Martín, Otorrino de Otoclínica y Director del Centro Otoclínica Granada.

Acúfenos. Manual de Ayuda

2011-11-29T20:44:00.000-08:00

Acúfenos. Manual de AYUDA

El tratamiento del acufeno ha sido siempre discutido y generalmente admitido por la clase médica de que tiene pocas posibilidades de solución. La teoría de la aceptación, el “tiene usted que habituarse a ello”, es la tónica general que el paciente suele escuchar cuando va a la mayoría de los centros médicos.

Aunque no existe un tratamiento único, en los últimos años, se han producido importantes cambios en el conocimiento y modo de entender los mecanismos que pueden provocar el acúfeno y en consecuencia se han desarrollado nuevas técnicas para tratar este problema.

En primer lugar hay que desenmascarar al acúfeno. Es decir hay que tratar de identificar cual es la causa u origen del acúfeno para proceder a diseñar la terapia y el modo de su abordaje.

Existen o hay muchas y variadas causas fisiopatológicas que pueden producir la sensación del acúfeno y por ello, es imprescindible una exploración médica y audiológica. Solo así se puede empezar, con un conocimiento del tipo de acúfeno al que nos enfrentamos. Un diagnóstico puede incluir una exploración auditiva para conocer, de una parte, el nivel sonoro del acúfeno, frecuencias principales de perturbación, posibles “puntos gatillo” de modulación, nivel de hiperacusia y otras variables audiométricas y patológicas del oído o de la anatomía muscular del cuello y cabeza. Pero también puede ser necesario, un análisis de los factores de riesgo cardiovasculares o antecedentes personales, detectando enfermedades circulatorias o metabólicas, u otros trastornos hormonales.

Recomendaciones y Pasos a Seguir por el afectado con Acúfenos.

1. No se alarme. Si es la primera vez que acaba de sentir ese sonido de forma espontánea, sin aparente causa, lo primero mantenga la calma. Debe usted saber que el sonido “aberrante” que escucha, es un síntoma y no es una enfermedad. Pero al igual que en otros síntomas es conveniente y necesario consultar con un médico especialista.

2. Solicite cita con su especialista. Si ya acudió al mismo y piensa que no obtuvo una respuesta convincente, solicite una segunda opinión. Aún así, aunque le hubieren indicado que, no hay cura, que no hay solución para su problema, nosotros no estamos de acuerdo. Tiene usted que saber que Si hay tratamientos, hay solución. “Y lo decimos con conocimiento de causa”.

3. No existe un tratamiento único contra los acúfenos que esté validado como universal. Y esto es lógico, porque no todos los acúfenos tienen la misma causa. Cada persona puede padecer acúfenos por diferentes problemas auditivos, por distintos cambios en su metabolismo y/o por diferentes problemas vasculares, por causas diversas de mal-funciones músculo esqueléticas, por alteraciones hormonales, etc..

4. Un diagnóstico oportuno y preciso es siempre necesario. Pero un diagnóstico acertado no es fácil y en todo caso en muchas ocasiones es muy complejo. Tenga paciencia controle su estrés y no se agobie; ese proceder empeorará todavía más el síntoma del acúfeno

5. Según qué tipo de tinnitus o acúfeno se trate, es decir dependiendo de su origen, la terapia elegida puede ser completamente ineficaz o viceversa. Pero no se desanime. A veces una terapia y decisión tan simple como un cambio de dieta y hábito de vida produce el efecto deseado; es decir que la alimentación puede hacer que el acúfeno remita a valores de percepción no molestos o incluso a su remisión total. Créalo es cierto que un tratamiento con cambio de alimentación, produce o equivale a un tratamiento con fármacos.

Pero ¿Cómo decidir cuál es mi terapia?

6. En una Unidad Médica especialista en el tratamiento de Acúfenos, con metodología y dedicación, el abordaje del acúfeno puede y debe ser tratado por un equipo multidisciplinar. La exploración y diagnóstico es lo más importante y en ocasiones, ya lo mencionamos, esto es complejo y requiere la intervención de varios especialistas médicos, audiólogos, psicólogos, etc...

7. Después de la exploración, estudio y valoración del trastorno, se toma la decisión de cuál es la terapia adecuada. No obstante en ocasiones se utiliza el método de prueba y error. (El método se inicia por aquella que se cree puede ser la eficaz; si no resulta así, se prueba con otra). Sin embargo esta metodología, no debe ser seguida indiscriminadamente por las personas afectadas sin un control médico. Y sabemos que ese es el modo de proceder de muchos pacientes, que muestran gran ansiedad por resolver su problema. Prueban y prueban sin control todo aquello que localizan. Este proceder sin control médico no es recomendable, ya que puede ocasionar mayores empeoramientos sin solución posterior.

8. La foto-terapia láser es una técnica que resulta eficaz sólo, en ciertos casos de “tinnitus o acúfenos”, cuando está originado en el oído interno. Son estos los más habituales, cierto, pero hay otras causas en las que se requiere el uso de otras terapias, tales como Neuromodulación, Terapia de Estimulación Acústica (TEA), Terapia Alimentaria/ o Farmacológica, Terapia Transcraneal Magnética, Terapia de Entrenamiento y habituación psicológica (TRT. Tinnitus Retraining Therapy), etc…

9. La terapia de láser actúa biológicamente, con mecanismos propios físico-químicos y sus efectos son equivalentes a los de un fármaco, pero sin crear otros efectos secundarios o adversos.

10. La terapia láser permite garantizar en el 50-55% de todos los casos de acúfenos, una recuperación contrastable por la mejoría del perfil audiológico de la persona tratada. Sin embargo existen otros casos de acúfenos cuya etiología u origen no es solucionable con la técnica de foto-terapia. Y en estos casos hay que utilizar otras técnicas terapéuticas, que también consiguen la remisión total o parcial del acúfeno. Pregunte a su médico cuando esto sea así o explíquenos su caso en una consulta informativa sin coste para usted. Pida una cita con nuestro Equipo Médico en OTOCLINICA, en el número 900 101 651 (llamada gratuita).

En nuestros Centros nos resistimos a tener que admitir el sentimiento general habitual, - “No hay solución, hay que acostumbrarse”. Le recordamos que existen varios otros tratamientos que pueden ser utilizados para encontrar la solución al problema del acúfeno, porque se ha comprobado que “si hay tratamientos, hay una posible solución también para Usted”.

El Equipo Médico
OTOCLINICA

Fuente: Material tomado, con permiso de OTOCLINICA, Centro médico de terapias auditivas, de España.

Pd. Nuestro agradecimiento a Joaquín Prósper, Director Clínico,OTOCLINICA, Centro Médico de Terapias Auditivas.
Príncipe de Vergara, 57, 1C, 28006 Madrid

email: consulta@otoclinica.es
web: www.otoclinica.es
Tel: (+34) 915 648 744

Progress in Hair Cell Regeneration

2011-11-28T11:06:00.000-08:00

HEARING LOSS – A BRIEF HISTORY

January 2001

As most of our readers probably know, most hearing loss is caused by deterioration of the hair cells in the cochlea.

The hair cells move in response to acoustic energy entering the ear, and stimulate the auditory nerve with information regarding the characteristics of the incoming sound.

Drugs, heredity, or loud noises can damage or destroy the hair cells, resulting in hearing loss.

We have known for some time that some animals (including many birds) can spontaneously regenerate damaged hair cells, but regeneration has never been observed in mammals – until now.

The August 26, 2000 Issue of the British medical Journal Lancet reported successful regeneration of hair cells in a postnatal rat cochlea by introducing a particular gene (Math1) to the cochlea. Researcher Wei-Qiang Gao (Genentech, San Francisco, CA,USA) points out, “It wasn’t just a few hair cells–we had several hundred, so it’s robust production”.

The next step in the investigation is to determine whether similar techniques can regenerate hair cells in mature rats. Success in these experiments would bode well for eventual hair cell regeneration in humans.

Another possibility to replace damaged hair cells is transplantation.

Matthew Holley (University of Bristol, UK) and his colleagues have developed an “ear in a test tube”, in which they have successfully grown mouse hair cells. Future advances may allow growth and transplantation of human hair cells.

Hair Cell Regeneration Update from the House Ear Institute – August 2001

The House Ear Institute has been actively involved in the research on hair cell regeneration. They are pursuing two complementary strategies in hopes of understanding the regeneration process and how to induce it in humans. Here’s a link to an article describing their recent work. http://www.hei.org/research/projects/cmb/haircellchall.htm

In vitro growth and differentiation of mammalian sensory hair cell progenitors: a requirement for EGF and periotic mesenchyme –

aGonda Department of Cell and Molecular Biology, House Ear Institute,
bCenter for Basic Neuroscience, University of Texas Southwestern Medical Center,
cDepartment of Cell and Neurobiology, University of Southern California Medical School,

24 September 2003; The sensory hair cells and supporting cells of the organ of Corti are generated by a precise program of coordinated cell division and differentiation.

Since no regeneration occurs in the mature organ of Corti, loss of hair cells leads to deafness.

To investigate the molecular basis of hair cell differentiation and their lack of regeneration, we have established a dissociated cell culture system in which sensory hair cells and supporting cells can be generated from mitotic precursors.

By incorporating a Math1-GFP transgene expressed exclusively in hair cells, we have used this system to characterize the conditions required for the growth and differentiation of hair cells in culture.

These conditions include a requirement for epidermal growth factor, as well as the presence of periotic mesenchymal cells.

Lastly, we show that early postnatal cochlear tissue also contains cells that can divide and generate new sensory hair cells in vitro.

Europe Issues Patent on Hearing Loss Treatment – October 2003

Editor: Here’s more breaking news on hair cell regeneration.

Sound Pharmaceuticals has been issued a European patent for its hair cell regeneration treatment.

Note that this development is only part of the required solution, and it doesn’t mean that a treatment will be widely available next week. But I think it is a big step towards viable hair cell regeneration.

Here’s the press release: Sound Pharmaceuticals, Inc. (SPI) announced that its patent “Method for the treatment of diseases or disorders of the inner ear” has issued in Europe, effective Oct. 1, 2003.

SPI has developed a novel strategy to stimulate auditory hair cell regeneration using proprietary cell cycle inhibition technology.

Typically, auditory hair cells in mammals are not replaced when injured or lost. This results in permanent and often progressive sensorineural hearing a disease that affects over 30 million in the US.

In non-mammals like birds, hair cell regeneration occurs through the spontaneous proliferation of the adjacent supporting cell.

These newly proliferating supporting cells can go on to become replacement hair cells.

However in mammals, auditory supporting cells do not proliferate or regenerate into hair cells even in the presence of growth factors.

SPI identified that p27Kip1, a cyclin dependent kinase inhibitor, prevents supporting cells from proliferating after embryogenesis.

Compounds developed by SPI to inhibit p27Kip1 have been shown to stimulate supporting cell proliferation after drug or noise induced hair cell loss.

“We are the only group that has demonstrated the ability to stimulate proliferative regeneration in the cochlea of mammals” says Dr. Jonathan Kil, President & CEO. “It is anticipated that this revolutionary technology will be critical in developing treatments to restore hearing in humans.”

Sound Pharmaceuticals, Inc. is a drug development company focused on treating hearing loss.

To date, Sound Pharmaceuticals’ drug discovery program has identified targets for the prevention of hearing loss and for the improvement of hearing in individuals with hearing loss.

For more information please visit http://www.soundpharmaceuticals.com

Transplantation of bone marrow stromal cells into the cochlea of chinchillas – 19 January 2004 – Volume 15 – Issue 1 – pp 1-4, Auditory and Vestibular Systems – Survival, migrational mobility and differentiation of autologous marrow cells in damaged cochlea suggest their potential as transplants for treatment of various degenerative inner ear diseases.

Promising Research on Hair Cell Regeneration – October 2004

Editor: For people interested in hearing loss “cures”, hair cell regeneration is the current best bet. It appears that virtually all animals except mammals regenerate hair cells on a routine basis.

Dr. Edwin W. Rubel [Virginia Merrill Bloedel Professor of Hearing Science, Virginia Merrill Bloedel Hearing Research Center, Otolaryngology-Head and Neck Surgery, Physiology and Biophysics, Psychology (Adjunct)] and his colleagues are among the researchers on the forefront of this exciting technology.

“Hearing Review” recently published an interview of Dr. Rubel along with a synopsis of the research status. Here’s one question and answer from the interview. The complete article is available at: http://www.hearingreview.com/Articles.ASP?articleid=H0410F01

Hearing Review: If hair cell regeneration is indeed possible, do you think this science will ever progress to a point where there will be full restoration of hair cells, or do you think that it’s far more likely we would see a partial restoration of hair cells in the inner ear?

Rubel: In my opinion, it’s not a question of if we will regenerate, restore, or protect hair cells, it’s a question of when. Because we now know that it’s possible, it’s only a matter of time until we can apply this science to humans. My best prediction is 10-20 years. I certainly hope to see it in my lifetime.

With respect to the degree of hair cell regeneration or restoration, my gut feeling is that it will all depend on what type of hearing loss a person has to begin with. One possibility for regeneration are people who have complete loss of hair cells due to some genetic anomaly, ototoxins, aminoglycosides, etc.

In these cases, hearing care professionals may someday have a choice between recommending a cochlear implant versus an approach for growing enough hair cells where hearing aids could be used more effectively and provide much more acoustic information to that patient.

As another example, you might see a patient who has a 50% loss of their outer hair cells. In this case, maybe we will be able to stimulate the regrowth and replacement of these “cochlear amplifier” cells.

Stem-cell researchers hope for deafness cure within 15 years – November 2004

Editor: “The Scotsman” is reporting on research at Sheffield University that may enable hearing restoration in the foreseeable future. Here are excerpts from the story. For the complete article, please point your browser to http://news.scotsman.com/uk.cfm?id=1346202004 SCIENTISTS hope that stem-cell research could lead to a cure for deafness in as little as ten years.

Researchers from Sheffield University are using embryonic stem cells in efforts to grow new cells in the inner ear. Although in its early stages, the team from Sheffield University hopes it could lead to a cure for deafness in ten to 15 years. Dr Rivolta added that his team hoped to undertake the first tests on animals in two years. “It could then be possible to do human trials in three to four years, but that would depend on the animal trials.”

Stem cells could cure deafness in ten years.

Scientists at Britain’s Sheffield University are hoping that stem cell research could lead to a cure for deafness within ten years!

Laboratory tests have demonstrated that embryonic stem cells have the capability to regrow in damaged areas; animal testing is planned within two years. Here’s the full story.

Survey and research on acute severe hearing disorders.

Study on the expression of cells similar to internal ear stem cell after acute acoustic trauma using a nestin GFP rat. – 2005 Rats that co-expressed nestin and GFP (green fluorescent protein) were used to study whether the presence of cells similar to internal ear stem cell could be identified using nestin, a filament of an intermediate size, as a marker.

In the cochlea of 4-week-old nestin-GRP rats, nestin-positive cells were observed only in spiral ganglion cells but not in the sensory epithelial cell layer comprising hair cells and supprt cells of Corti organ.

A very small number of nestin-positive cells were observed inside the Corti organ in the cochlea of the rats loaded with band noise at 4 kHz and 125 dB for two hours. Cells similar to internal ear stem cell are deemed likely to differentiate to support cells or hair cells. Regeneration therapy of cochlea hair cells was suggested to be possible.

Stem Cells May Be Key To Deafness Cure – August 2006

In a dusty, cluttered lab at Stanford University, a team of young scientists is on a quest. Curing deafness is the goal, reports CBS News correspondent Elizabeth Kaledin, and Stefan Heller says stem cells hold the key. Heller and his entire team were recruited away from Harvard, and they’ve made a breakthrough discovery: They’ve found that stem cells have the capacity to regenerate in the inner ear. Full Story

Stem cell based therapy to restore nearly normal hearing Nov 2006 – hearing in humans. The current review focuses on stem cell-based therapy with particular emphasis to summarize …. restored hearing loss, which demonstrates their potential ….

First blood and bone stem cell research on deafness – December 2006 – Deafness Research UK is funding a new research programme that will be the first to try and develop a cure for deafness using stem cells taken from umbilical cord blood or bone marrow.

This three-year project will be based in the Centre for Stem Cell Biology at the University of Sheffield and has been made possible by a £126,000 charitable donation from GlaxoSmithKline (GSK).

It will be the first research to use these promising new lines of stem cells, which are less controversial than stem cells derived from human embryos, in the search for a cure for deafness. Full Story

COSM 2007: Triological Society – Stem Cell and Genetic Therapies for Hair Cell-Related Hearing Loss

Neil Segil, PhD, from the House Ear Institute, discussed the potential of hair cell regeneration with endogenous progenitor cells—specifically supporting cells. In mice, Dr. Segil’s team tested the capacity of cochlear supporting cells to divide and transdifferentiate by using green fluorescent markers expressed only in supporting cells in the inner ear. With the resulting purified supporting cells, the scientists discovered that the cells were still capable of self-division. And, although these cells normally wouldn’t actively divide, under the culture conditions in the lab, they did.

“If we keep these cells in culture for six days, some of the cells begin to differentiate as hair cells,” he said, adding that they have not yet identified the stimulus for the division. What they did determine is that self-division is age-dependent, in early cells.

It is important, Dr. Segil said, to further test whether self-division can be stimulated in mature cells.

In another study, Dr. Segil’s team is targeting one pathway that keeps cells next to each other from differentiating as the same cell type.

They believe that supporting cells are being actively inhibited from becoming hair cells by this pathway. Additional projects look at cell differentiation to better understand the process by which the supporting cell differentiated state is maintained.

Tech Could End Deafness – February 2007

“We have a good chance of getting normal hearing back in normal ears,” said Richard Schmiedt, an otolaryngology professor at the Medical University of South Carolina. The stem-cell approach involves restoring the tiny “hair cells” in the ear that convert sound into electrical impulses.

When the cells die, people permanently lose their hearing. Bringing back the cells through stem-cell transplants, along with a shock of electricity, could restore hearing, scientists say.

At Stanford University, professor Stefan Heller, who discovered stem cells in the inner ear, believes they can be used to cure deafness in mice within five years. Heller and his colleagues are trying to learn from birds, which do not become deaf, the secret genetic recipe for warding off hearing loss. Full Story

The Miracle of Hair Cells and Prospects for Regrowth – June 2007

Here’s a great article that explains the structure and function of inner and outer hair cells and also looks at some of the research into regrowing these cells. If you’re interested in this topic, it’s very much worth the read! Full Story

Stem Cell Therapy Recovers Lost Hearing – June 2007

Stem cells injected into the inner ear survived in half of the injured rats, where they migrated away from the site of injection toward the injured region within the inner ear.

These stem cells divided in the new environment and expressed several proteins necessary for hearing, suggesting tissue-specific differentiation. Further, transplanted cells that migrated to the damaged area of the inner ear displayed shape similar to that of cochlear fibrocytes.

Importantly, transplanted rats exhibited faster recovery from hearing loss, particularly in the high frequency range, which is difficult to restore by natural regeneration.

Stem cell migration into the damaged area of the inner ear improved hearing of high frequency sound (40 kHz) by 23% compared to natural recovery in untreated animals. Full Story

Genes In Human Inner Ear Cells Restored – June 2007

Dr. Jeffrey Holt, associate professor of neuroscience and otolaryngology at UVa, and his research team, including Dr. Bradley Kesser, an assistant professor of otolaryngology, targeted a gene known as KCNQ4, which causes genetic hearing loss in humans when mutated.

They engineered a correct form of the gene and created a gene therapy delivery system that successfully transferred the KCNQ4 gene into human hair cells harvested from the inner ears of patients with hearing loss.

“Our results show that gene therapy reagents are effective in human inner ear tissue.

Taken together with the results from another group of scientists who showed that similar gene therapy compounds can produce new hair cells and restore hearing function in guinea pigs suggest that the future of gene therapy in the human inner ear is sound,” Holt said. Full Story

Researchers Develop New Method of Growing Hair Cells – November 2007 – Researchers at the University of Virginia have developed a new method of growing inner-ear hair cells that will aid research to help people regain their hearing.

Dr. Jeffrey T. Corwin, a professor of neuroscience at the UVa Health System, and Dr. Zhengqing Hu, a neuroscience research assistant, have been growing cells from inner ears of chicken embryos.

They hope to extend that knowledge to re-grow the inner-ear hair cells of humans. Mammals grow inner-ear hair cells only before they are born, unlike amphibians and birds, which can re-grow damaged or lost cells.

These unique structures are lost over time as mammals age, or if they contract certain infections or undergo trauma.

The loss of inner-ear hair cells results in hearing loss and balance impairment.

Hu and Corwin’s process is able to grow chicken inner-ear hair cells in a laboratory setting. Full Story

Mesenchymal Stem Cell Transplantation Accelerates Hearing Recovery through the Repair of Injured Cochlear Fibrocytes – (American Journal of Pathology. 2007;171:214-226.) DOI: 10.2353/ajpath.2007.060948 – From the Laboratory of Auditory Disorders* and Division of Hearing and Balance Research, National Institute of Sensory Organs, and the Department of Plastic Surgery, National Tokyo Medical Center, Tokyo, Japan – Cochlear fibrocytes play important roles in normal hearing as well as in several types of sensorineural hearing loss attributable to inner ear homeostasis disorders.

Recently, we developed a novel rat model of acute sensorineural hearing loss attributable to fibrocyte dysfunction induced by a mitochondrial toxin. In this model, we demonstrate active regeneration of the cochlear fibrocytes after severe focal apoptosis without any changes in the organ of Corti.

To rescue the residual hearing loss, we transplanted mesenchymal stem cells into the lateral semicircular canal; a number of these stem cells were then detected in the injured area in the lateral wall.

Rats with transplanted mesenchymal stem cells in the lateral wall demonstrated a significantly higher hearing recovery ratio than controls.

The mesenchymal stem cells in the lateral wall also showed connexin 26 and connexin 30 immunostaining reminiscent of gap junctions between neighboring cells.

These results indicate that reorganization of the cochlear fibrocytes leads to hearing recovery after acute sensorineural hearing loss in this model and suggest that mesenchymal stem cell transplantation into the inner ear may be a promising therapy for patients with sensorineural hearing loss attributable to degeneration of cochlear fibrocytes.

Directed differentiation of mouse cochlear neural progenitors in vitro- 18 June 2008 – Departments of 1Otolaryngology and 2Neurosurgery, 3Graduate Program in Neuroscience, 4Stem Cell Institute, and 5Bioengineering, University of Minnesota, Minneapolis, Minnesota – Multipotent cochlear neural progenitors (CNPs) in the organ of Corti hold the promise for cell replacement in degenerative hearing disorders.

However, not much is known about the CNPs and the specific conditions for their differentiation. Here we isolate the CNPs from the postnatal day 1 organ of Corti in mice and demonstrate their capability to self-renew and to differentiate into hair cell-like and neuronal cell-like phenotypes under the guidance of sonic hedgehog (SHH), epidermal growth factor (EGF), retinoic acid (RA), and brain-derived neurotrophic factor (BDNF), herein termed SERB (abbreviation of SHH, EGF, RA, and BDNF) in an asymmetric or symmetric manner from clonal isolates.

Differentiation of CNPs into hair cells by SERB was dependent on the ERK signaling pathway, whereas the differentiation of CNPs into neurons by SERB was not.

This work develops a new in vitro methodology for the maintenance and self-regeneration of CNPs for future design of regenerative strategies for hearing disorders.

Novel approaches to treating sensorineural hearing loss. Auditory genetics and necessary factors for stem cell transplant.

2008 Aug;14(8):RA114-25. Sensorineural hearing loss is a chronic disease, with a serious impact on human communication and quality of life.

Exposure to various factors can lead to irreversible hearing impairment, as the auditory epithelium in humans comprises terminally differentiated cells. By contrast, the inner ear of lower vertebrates and invertebrates shows regenerative capacity.

Efforts to regenerate the damaged human inner ear may involve renewed cell proliferation, or transplanting cells that can differentiate into sensory cells. Literature review.

Animal studies, in vitro studies, retrospective-cohort studies, community-based case-controls, clinical guidelines, and review articles. Embryonic stem cells, inner ear stem cells, and stem cells from other tissues (i.e., neural tissue, hematopoietic system) may be candidates for restoring the auditory epithelium.

Transcriptional regulation of p27kip1 is the primary determinant of terminal mitosis and the final number of postmitotic progenitors of hair and supporting cells.

Basic helix-loop-helix transcription factor Math1 was found to be necessary and sufficient for the production of auditory hair cells.

Notch signaling seems to play a major role in the regulation of Math1, through lateral inhibition. Brn3c, Gfi1, and Barhl1 are also specific transcription factors that have been implicated in hair cell maintenance and consequent survival.

Evidence concerning development, maintenance, and regeneration of hair cells is still at an embryonic stage. Combined data, as attempted in the present study, will lead to a more successful management of deafness.

Sensory Cell Regeneration and Stem Cells: What We Have Already Achieved in the Management of Deafness – Otology & Neurotology: September 2008 – Volume 29 – Issue 6 – pp 758-768, doi: 10.1097/MAO.0b013e31817fdfad – There is an already exciting progress in the fields of sensory cell regeneration and SC research in an attempt to restore hearing or prevent deafness.

However, further understanding of the underlying mechanisms of auditory genetics, continuing investigation of the human genome, refinement of the delivering techniques, and specification of the therapeutic strategies have to be developed before functional regeneration of the cochlea can be achieved in clinical practice.

Umbilical Stem Cells May Repair Damaged Cochlear Hair Cells – September 2008

According to an Italian research team publishing their findings in the current issue of Cell Transplantation (17:6), hearing loss due to cochlear damage may be repaired by transplantation of human umbilical cord hematopoietic stem cells (HSC) since they show that a small number migrated to the damaged cochlea and repaired sensory hair cells and neurons.

For their study, the team used animal models in which permanent hearing loss had been induced by intense noise, chemical toxicity or both.

Cochlear regeneration was only observed in animal groups that received HSC transplants.

Researchers used sensitive tracing methods to determine if the transplanted cells were capable of migrating to the cochlea and evaluated whether the cells could contribute to regenerating neurons and sensory tissue in the cochlea. Full Story

Researchers Make in Vitro Inner Ear Hair Cells – November 2008

Iranian researchers managed to successfully extract bone marrow stem cells from rodents and produce in vitro inner ear hair cells. “In this two-year project, researchers cultured and produced inner ear hair cells, a procedure which is not commonly performed in other countries,” research team-leader, Mohammad Farhadi told the Iranian students news agency.

Farhadi reported that injecting the resulted cells into deaf mice has successfully tackled hearing loss in them. Full Story

New Stem Cell Therapy May Lead To Treatment For Deafness – ScienceDaily (Mar. 23, 2009) — Deafness affects more than 250 million people worldwide. It typically involves the loss of sensory receptors, called hair cells, for their “tufts” of hair-like protrusions, and their associated neurons.

The transplantation of stem cells that are capable of producing functional cell types might be a promising treatment for hearing impairment, but no human candidate cell type has been available to develop this technology.

A new study led by Dr. Marcelo N. Rivolta of the University of Sheffield has successfully isolated human auditory stem cells from fetal cochleae (the auditory portion of the inner ear) and found they had the capacity to differentiate into sensory hair cells and neurons…”The results are the first in vitro renewable stem cell system derived from the human auditory organ and have the potential for a variety of applications, such as studying the development of human cochlear neurons and hair cells, as models for drug screening and helping to develop cell-based therapies for deafness,” say the authors.

Stem cells may help deaf people hear – April 2009 – Stem cells may help deaf people hear again, according to early stage research by British scientists. A team at the University of Sheffield said on Thursday they had discovered how to turn stem cells into ones that behave like sensory hair cells or auditory neurons, which could then be surgically inserted into the ear to restore lost hearing. Lead researcher Marcelo Rivolta said the approach, which is being tested on animals, held significant potential but was a long way from being offered to patients. Full Story

Hair Cell Regeneration – How It Works and What It Means for Audiologists – May 2009 – Twenty years have passed since the discovery of hair cell regeneration in birds (Corwin & Cotanche, 1988; Ryals & Rubel, 1988).

The initial excitement caused by this discovery has been followed by steady progress in understanding the fundamental mechanisms that recently culminated in research evidence of hair cell regeneration in both the auditory and vestibular portions of the mammalian inner ear (Kawamoto et al., 2003; Izumikawa et al., 2005; Staecker et al., 2007).

Clinical audiologists are faced with the responsibility of translating these basic science findings into potential patient application.

They raise important questions: When will hair cell regeneration be a reality for my patients? What will be the measures of candidacy? What will the impact of hair cell regeneration be in my patients who use or are candidates for hearing aids or other amplification devices? Will hearing aids or cochlear implants continue to be needed in the face of hair cell regeneration?

Full Story: Regrowing Hair Cells in the Human Cochlea – June 2009

More than 20 years ago, Douglas Cotanche, PhD, then at the Medical University of South Carolina and now affiliated with Children’s Hospital Boston, discovered that the hair cells within the chick cochlea were capable of a “significant amount of recovery and regeneration” following acoustic trauma.1

His unexpected discovery began a cascade of research on the question of whether hair cells within the human cochlea could someday achieve the same regenerative results.

If and when this happens, many of the causes of hearing loss in humans, from noise to aging, can finally be resolved without the need for hearing aids or cochlear implants.

Although steady progress has been made in understanding the mechanisms underlying hair cell regeneration, human subjects have yet to participate in clinical trials concerned with regrowing hair cells. Such trials may still be years away. Let’s look at a sampling of the research in 2008, which moves us ever closer to the goal of restoring hearing in this most natural way. Full Story

Can a Tiny Fish Save Your Ears? – August 2009

For many people, loss of hearing is irreversible. For scientists trying to figure out what can be done about that, one answer may lie-or swim, actually-in freshwater aquariums.

About one of every 10 Americans suffers from hearing impairment, according to a survey conducted by the Better Hearing Institute, a nonprofit advocacy group.

By far the most common cause of hearing loss is damage to the so-called hair cells in the inner ear as a result of excessive noise, certain illnesses and drugs, and simple aging.

The problem is that once hair cells die, humans (like other mammals) aren’t able to grow new ones.

In recent years, a research team at the University of Washington in Seattle has been working on finding a way to resolve that problem in experiments involving the zebrafish, a common aquarium denizen.

The zebrafish, like many aquatic creatures, has clusters of hair cells running along the outside of its body that help sense vibrations in the water, working in a similar way to hair cells in the human inner ear.

But unlike humans, zebrafish are able to regenerate their damaged hair cells. Researchers hope their work can unlock secrets to protect human hair cells from becoming damaged and to stimulate the cells to regenerate.

Full Story:Cord Blood Stem Cells Repair Mouse Inner Ear – August 2009

Results: The authors found that HSC migrated and engrafted into the cochlea of the deaf mice and that the levels of engraftment correlated with both the severity of damage and the treatment dose.

Analysis at 60 days post-treatment showed that the mice in the HSC treatment group had well-repaired cochlea with dramatic hair cell regrowth, while control mice showed no sign of repair or hair cell regeneration.

Conclusion: The study shows dramatic repair of cochlear damage in mice after intravenous infusion of cord blood HSC, suggesting a potential therapeutic strategy using cord blood stem cells in hearing rehabilitation therapies. Full Story

Regeneration of the mammalian inner ear sensory epithelium – Oct 2009 – …focus on ‘self-repair’ of the mammalian inner ear sensory epithelium, including recruiting the in-situ proliferation and differentiation of endogenous cells at the damaged site and the autologous transplantation

and finally…

Stem Cells Cure Hearing Loss? – November 2009 – Chloe had to travel outside of the United States for stem cell treatment for her hearing disorder.

Chloe’s hearing was tested two months after the procedure was completed on October 16, 2009.

The results were spectacular. The left ear improved to 50% from 0%. The right ear gained almost complete hearing. http://repairstemcell.wordpress.com/2009/11/05/stem-cells-heal-hearing-loss/

(much thanks to hearinglossweb.com for compiling many of these articles!)

To find out if you are a candidate for stem cell therapy for your hearing disorder, contact me at dsgrano@gmail.com –

The information is free and there is no obligation.

Autor: David Granovsky
Fuente:The Stem Cell Blog
http://repairstemcell.wordpress.com/2009/11/16/hearing-loss-%E2%80%93-a-brief-history/

Nestin-expressing cells in the developing, mature and noise-exposed cochlear epithelium

2011-11-28T10:48:00.000-08:00

Reiko Watanabea, c, Maria H. Morellb, d, Josef M. Millera, Ariane Kanickia, K. Sue O'Sheab, Richard A. Altschulera, b, Yehoash Raphaela, Corresponding Author Contact Information, E-mail The Corresponding Author

a Kresge Hearing Research Institute, Department of Otolaryngology, University of Michigan, Ann Arbor, MI 48109-5648, USA
b Department of Cell and Developmental Biology, University of Michigan, Ann Arbor, MI 48109-5648, USA
c Department of Otolaryngology, Keio University, 35 Shinanomachi, Shinjuku, Tokyo 160-0016, Japan
d Instituto de Parasitologia y Biomedicina López Neyra, 18100 Armilla, Granada, Spain

Available online 20 November 2011.

Abstract

The auditory sensory epithelium in non-mammalian vertebrates can replace lost hair cells by transdifferentiation of supporting cells, but this regenerative ability is lost in the mammalian cochlea.

Future cell-based treatment of hearing loss may depend on stem cell transplantation or on transdifferentiation of endogenous cells in the cochlea.

For both approaches, identification of cells with stem cell features within the mature cochlea may be useful.

Here we use a Nestin-β-gal mouse to examine the presence of Nestin positive cells in the mature auditory epithelium, and determine how overstimulation of the ear impacts these cells.

Nestin positive cells were found in the apical turn of the cochlea lateral to the outer hair cell area.

This pattern of expression persisted into mature age.

The area of Nestin positive cells was increased after the noise lesion.

This increase in area coincided with an increase in expression of the Nestin mRNA. The data suggest that cells with potential stem cell features remain in the mature mammalian cochlea, restricted to the apical turn, and that an additional set of signals is necessary to trigger their contribution to cell replacement therapy in the ear.

As such, this population of cells could serve to generate cochlear stem cells for research and potential therapy, and may be a target for treatments based on induced transdifferentiation of endogenous cochlear cells.

Keywords: Cochlea; Nestin; Deafness; Development; Mouse; Stem cell; Acoustic trauma
Article Outline

Corresponding Author Contact InformationCorresponding author at: MSRB-3 Rm. 9220B, 1150 W. Med. Cntr. Dr., Ann Arbor, MI 48109-5648, USA.

Fuente: Molecular and Cellular Neuroscience
doi:10.1016/j.mcn.2011.11.001

Longitudinal hypothalamic–pituitary–adrenal axis trait and state effects in recurrent depression

2011-11-28T10:40:00.000-08:00

Authors.
Anja Loka, Corresponding Author Contact Information, 1, E-mail The Corresponding Author, Roel J.T. Mockinga, 1, Henricus G. Ruhéa, Ieke Vissera, Maarten W.J. Koetera, Johanna Assiesa, Claudi L.H. Bocktingb, Miranda Olffc, Aart H. Schenea
Purchase
a Program for Mood Disorders, Department of Psychiatry, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands
b Department of Clinical and Experimental Psychology, University of Groningen, Groningen, The Netherlands
c Center for Psychological Trauma, Department of Psychiatry, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

Available online 17 November 2011.
Summary
Background

Hypothalamic–pituitary–adrenal (HPA)-axis hyperactivity has been observed in (recurrent) major depressive disorder (MDD), although inconsistently and mainly cross-sectional.

Longitudinal studies clarifying state-trait issues are lacking.

We aimed to determine whether HPA-axis (hyper)activity in recurrent MDD is:

(I) reflecting a persistent trait;
(II) influenced by depressive state;
(III) associated with stress or previous episodes;
(IV) associated with recurrence; and
(V) influenced by cognitive therapy.

Methods

We included 187 remitted highly recurrent MDD-patients (mean number of previous episodes: 6.3), participating in a randomized-controlled-trial investigating the preventive effect of additional cognitive therapy on recurrence.

In an add-on two-staged patient-control and prospective-cohort design, we first cross-sectionally compared patients’ salivary morning and evening cortisol concentrations with 72 age- and sex-matched controls, and subsequently longitudinally followed-up the patients with repeated measures after three months and two years.

Results

Patients had higher cortisol concentrations than controls (p < .001), which did not change by MDD-episodes during follow-up. HPA-axis activity had no relation with daily hassles or childhood life events.

Cortisol concentrations were lower in patients with more previous episodes (p = .047), but not associated with recurrence(s) during follow-up. Finally, randomly assigned cognitive therapy at study-entry enhanced cortisol declines over the day throughout the two-year follow-up (p = .052).

Conclusions

Our results indicate that remitted recurrent MDD-patients have a persistent trait of increased cortisol concentrations, irrespective of stress.

In combination with our finding that patients’ cortisol concentrations do not change during new MDD-episodes (and thus not represent epiphenomenal or state-effects), our results support that hypercortisolemia fulfills the state-independence criterion for an endophenotype for recurrent depression.

Keywords: Depressive disorder; Major; Recurrence; Hypothalamo-hypophyseal system; Pituitary–adrenal system; Glucocorticoids; Saliva; Cohort studies; Case–control studies; Randomized controlled trial; Cognitive therapy

Corresponding Author Contact InformationCorresponding author at: Department of Psychiatry, Academic Medical Center, Meibergdreef 5, Amsterdam 1105 AZ, The Netherlands. Tel.: +31 205669111.

Fuente: Psychoneuroendocrinology
doi:10.1016/j.psyneuen.2011.10.005

Genetics of temporal lobe epilepsy

2011-11-28T10:35:00.000-08:00

Su-Kyeong Hwang, Shinichi Hirose Corresponding Author Contact Information, E-mail The Corresponding Author

Department of Pediatrics, School of Medicine, Fukuoka University, Fukuoka, Japan
Central Research Institute for the Pathomechanisms of Epilepsy, Fukuoka University, Fukuoka, Japan

Abstract

The most common partial epilepsy, temporal lobe epilepsy (TLE) consists of a heterogeneous group of seizure disorders originating in the temporal lobe.

TLE had been thought to develop as a result of acquired structural problems in the temporal lobe.

During the past two decades, there has been growing evidence of the important influence of genetic factors, and familial and non-lesional TLE have been increasingly described.

Here, we focus on the genetics of TLE and review related genes which have been studied recently.

Although its molecular mechanisms are still poorly understood, TLE genetics is a fertile field, awaiting more research.

Keywords: Temporal lobe epilepsy; Genetics; Mutation; ADLTE; FMTLE; FPEVF
Article Outline

1. Introduction
2. Autosomal dominant lateral temporal lobe epilepsy (ADLTE)
2.1. LGI1: the only confirmed causal gene for ADLTE
3. Familial mesial temporal lobe epilepsy (FMTLE)
3.1. A number of candidate genes and loci have been suggested
3.2. FMTLE with hippocampal sclerosis
3.3. FMTLE with febrile seizures
3.4. Genetic markers for pharmacoresistant MTLE
4. Familial partial epilepsy with variable foci (FPEVF)
4.1. Two loci for FPEVF have been identified
5. Animal experiments
6. Gene therapy
7. Discussion
8. Summary
Acknowledgements
References

Corresponding Author Contact InformationCorresponding author. Address: Department of Pediatrics, School of Medicine, Fukuoka University, 45-1, 7-chome Nanakuma, Jonan-ku, Fukuoka 814-0180, Japan. Tel.: +81 92 801 1011; fax: +81 92 862 6955.

Fuente: Brain and Development
doi:10.1016/j.braindev.2011.10.008
Available online 20 November 2011.

Home Remedies For Tinnitus, Easy And Simple Natural Cure

2011-11-28T10:25:00.000-08:00

Tinnitus is the buzzing or ringing sound inside one or both the ears.

It may come and go or may be continuous.

People suffering from tinnitus hear wide range of noises inside their ears.

Tinnitus is basically of two types’ objective and subjective tinnitus.

In the case of objective tinnitus the patient as well as the people around him can hear the buzzing sound inside his ears.

And in subjective tinnitus only the patient hears the buzzing sound inside his ears.

There are many causes for tinnitus such as allergy, aging, exposure to the loud noises, blood circulation problems and head or neck injury resulting in the damage of hearing nerve in inner ear.

Home remedies for tinnitus come in various forms and one can always choose the best suited home remedy.

Use of apple cider vinegar is one of the most common home remedies for tinnitus. All you have to do is drink a solution of water (eight ounces) and apple cider vinegar (two tablespoons).

It will give you relief from ringing and is most effective in allergy related tinnitus.

Eating pineapple most often helps in curing tinnitus related to inflammation.

You can even try spraying into the throat and nose a mixture of glycerin (one teaspoon) and salt (one teaspoon) three times a day.

This will treat problems related to sinus as well as ringing in the ears.

Consume raw garlic daily in order to get relief from tinnitus problem.

Ginkgo biloba helps in improving blood circulation to the neck and head region, which will provide relief to tinnitus sufferers.

Chewing dry fruits also help in improving blood circulation and is considered beneficial in treating tinnitus related problems.

One of the effective home remedies for tinnitus is to put 20 to 40 milligrams of Maidenhair tree extract inside your ears.

Because of the loud noise many people suffer tinnitus.

It is recommended to wear ear plugs in such cases.

You can even try aromatherapy. Rose, rosemary, cypress or lemon oils can be used to treat tinnitus related to circulation problems.

Put any of these oils in a vaporizer which will put the scent into the air surrounding you.

You should avoid tea, chocolate or coffee which is rich in caffeine.

Avoid soft drinks, alcohol and smoking.

Stay away from foods like dairy products, saturated fats, salt, sugar and processed foods.

Eat a protein rich diet along with vegetables and fresh fruits.

Also try to have a diet rich in zinc, chlorine, vitamin E, Vitamin B and Vitamin A.

These home remedies for tinnitus as mentioned above are simple, easy and safe to use.

Fuente: http://enbusca.com/home-remedies-tinnitus-easy-simple-natural-cure/

11.24.2011

Them Crooked Vultures y el tinnitus

2011-11-28T10:11:00.000-08:00

RyR Escrito por: RyR, el 23 de November de 2011 | 3:30 pm

No vuelvas a salir sin tus tapones de oídos, especialmente si vas a un concierto de Them Crooked Vultures, la banda conformada por Josh Homme de Queens of the Stone Age, Dave Grohl de los Foo Fighters y John Paul Johnes de Led Zeppelin.

Robert McIndoe, un hombre inglés de 52 años, lo hizo y lo lamentó hasta el momento en que, supuestamente, se suicidó por no soportar el tinnitus (ese beeeeeeep sostenido que generalmente desaparece unas horas después de escuchar sonidos muy altos) que le provocó el concierto y que le impidió dormir durante tres meses hasta que finalmente se inflingió una puñalada mortal el 31 de octubre pasado (después de intentar suicidarse con somníferos 15 días antes).

Su esposa declaró a que “Cuando comenzó no le importó mucho porque creía que pasaría (el tinnitus), el amigo que lo acompañó al concierto también lo tuvo.

Pero para Robert era una molestia constante.

No logró dormir ni una noche después de eso”.

Fuente: http://www.rockandroll.com.mx/blog/2011/11/them-crooked-vultures-y-el-tinnitus/

NOTA DE LA REDACCIÓN:
Un tratamiento médico apropiado seguramente habría ayudado al oyente y paciente Robert Mc Indoe a superar sus acúfenos agudos, una proteccion auditiva con protectores de oido adecuados habría evitado que los acufenos aparecieran, estos casos extremos son exactamente eso, casos excepcionales y extremadamente infrecuentes de evolucion de pacientes con acúfenos.

Dysfunction of fronto-limbic brain circuitry in depression

2011-11-28T10:04:00.000-08:00

Authors:
C. Liaoa, Z. Fenga, Corresponding Author Contact Information, E-mail The Corresponding Author, D. Zhoub, Q. Daia, B. Xieb, B. Jib, X. Wangb, X. Wangc
Purchase
a Educational Center of Mental Health, Third Military Medical University, Chongqing 400038, China
b Radiology Department, Southwest Hospital, Third Military Medical University, Chongqing 400038, China
c Xuanwu Hospital, Beijing 100053, China

.
Abstract

Background: depression is characterized by a stable negative bias toward emotional stimuli.

This bias is associated with abnormal activities in emotion-processing regions (such as the amygdala) and cognitive-control regions (such as the dorsolateral prefrontal cortex [DLPFC]).

However, it remains unclear whether the emotion-processing and cognitive-control regions affect negative cognitive bias independently or reciprocally.

Experimental procedure: a functional magnetic resonance imaging (fMRI) study of 16 depressed patients and 16 matched control subjects was conducted during an emotion-interference task.

Results: the accuracies were significantly lower in the depressed group than in the control group when subjects attended to the happy and the neutral faces.

Compared with control participants, depressed patients showed abnormal activity in bilateral amygdala and the right DLPFC.

In addition, a significant correlation was found between the right amygdala and the right DLPFC when subjects observed happy faces.

Conclusions: the results suggest that the dysfunctions in positive emotion-processing and cognitive-control regions may reciprocally affect negative cognitive bias.

Additionally, altered positive emotional interference processing in the fronto-limbic brain circuitry might be another cause of negative cognitive bias that finally leads to depression.

Highlights

▶Emotion-processing and cognitive-control regions affect negative cognitive bias. ▶Depressed patients showed dysfunctions in the right amygdala and the right dorsolateral prefrontal cortex. ▶A significant correlation was found between the two regions.

Key words: depression; emotional processing; cognitive control; brain circuitry; fMRI

Abbreviations: ACC, anterior cingulate cortex; BDI, Beck Depression Inventory; CCMD-3, Chinese Classification of Mental Disorders; DLPFC, dorsolateral prefrontal cortex; fMRI, functional magnetic resonance imaging; FOV, field of view; MDD, major depressive disorder; ROI, regions of interest; RT, reaction time; SDS, Self-rating Depression Scale; TE, time-to-echo; TR, repetition time

Fuente: Neuroscience
doi:10.1016/j.neuroscience.2011.10.053
Available online 22 November 2011

Tinnitus: zumbido que no cesa

2011-11-28T09:57:00.000-08:00

Esos zumbidos frecuentes en el oído no son normales. El tinnitus se define como un ruido similar a un campaneo, zumbido, o silbido. Es una sensación percibida individualmente, que puede ser continua o intermitente. El atinnitus o acúfenos puede ser definido como el ruido que la persona oye y percibe como si proviniera de su oído, cabeza, o ambos, cuando no existe en el exterior.

El Dr. Jorge Francisco Moisés Hernández, Otorrinolaringólogo, Jefe del Área de Cirugía Endoscópica del Hospital General de México, lo define como la percepción de algún sonido que no existe, pero que el paciente refiere.

El tinnitus es común en personas mayores de 40 años, pero cada vez es más frecuente en jóvenes, debido al aumento de los niveles de ruido cotidianos, incluyendo los causados por el uso incontrolado de aparatos portátiles de música. Aunque el tinnitus es más común entre las personas que sufren pérdida de audición, cualquier persona puede sufrirlo.

No es una enfermedad, sino un síntoma que ocurre con frecuencia; afecta al 17% de la población mundial. En casos muy severos altera la calidad de vida, en circunstancias como concentración y sueño. Se reporta que el tinnitus se asocia a Hiperacusia (es la disminución en la tolerancia al sonido) en aproximadamente 40% de los casos.

“Se calcula que 6 de cada 10 personas han presentado en algún momento de su vida algún acufeno, un zumbidito en el oído. Las probabilidades de presentar un acufeno pasando los 40 años, se incrementa hasta un 12%”, señala el Dr. Moisés Hernández.

Algunos consejos que pueden ayudarte son : evitar la ansiedad o el estrés, tener un descanso adecuado y evitar la fatiga, evitar el uso de estimulantes, incluyendo el café, el alcohol y el tabaco, evitar las situaciones que más pueden dañar la audición (ruido excesivo), y proteger las orejas de lesiones y riesgos laborales. Use ropa protectora para los oídos cuando sea apropiado.

En la actualidad gracias al avance médico y tecnológico, ya existe un tratamiento que quita o disminuye significativamente la presencia del molesto acúfeno.

El Dr. Jorge Francisco Moisés Hernández asegura que el Gingko Biloba tiene la ventaja de mejorar el aporte sanguíneo, la circulación y la oxigenación y eso hace que las células sean más resistentes a las agresiones, a los traumas, a la exposición al ruido, o a situaciones como colesterol alto que también puede ir tapando vasos, e ir generando un daño mayor.

Los usos terapéuticos del extracto especial de Ginkgo Biloba EGB 761® comprobados clínicamente, incluyen la mejoría sintomática de mareos, tinnitus y cefaleas así como para el déficit de memoria y de atención; depresiones. Este fitofármaco tiene la ventaja de que en su composición ubica varios elementos, como ginkólidos los cuales tienen un efecto antiinflamatorio muy parecido a los esteroides. También tiene efecto a nivel de la agregación plaquetaria, la responsable de formar trombos, cabe destacar que además posee una reacción positiva a nivel de metabolismo celular. Dependiendo de los síntomas y del tratamiento será la dosis que se recomienda.

Existe una gran variedad de condiciones o enfermedades que eventualmente podrían desencadenar tinnitus. Algunos ejemplos son un tapón de cerumen, infección en oído, y con menor frecuencia un tumor en el nervio auditivo. Pero aun así, no se cuenta con una causa precisa que explique en su totalidad la presentación del tinnitus.

Otras condiciones médicas relacionadas son: Hipertensión arterial, Enfermedades cardiovasculares, anemia, e hipotiroidismo. La causa más común relacionada con el tinnitus es la exposición a sonidos o ruidos de alta tonalidad, se tienen en cuenta otros factores como el alcohol, tabaquismo, bebidas oscuras con cafeína, la ansiedad, estrés y preocupaciones.

De acuerdo a lo anterior el tinnitus no se asocia a alteraciones serias; sin embargo, se recomienda consultar para intentar detectar su causa de origen por la valoración y examen físico realizados por un otorrinolaringólogo.

Autor Bertha Sola | Bienestar
2011-11-24
Fuente: http://www.cronica.com.mx/nota.php?id_nota=618909
Mexico

«El médico debería estar obligado a una evaluación continua»

2011-11-28T09:23:00.000-08:00

GENERACIÓN XXI: FÉLIX DÍAZ CAPARRÓS

El otorrinolaringólogo cartagenero, pionero en novísimos implantes auditivos, sugiere reformas en la sanidad pública para facilitar la formación de profesionales
26.11.11 - 00:38 -
GINÉS CONESA |

QUIÉN ES
Nombre: Félix Díaz Caparrós.
Lugar y año de nacimiento: Cartagena, 1967.
Profesión: Médico otorrinolaringólogo.
Estado civil: Casado con Ana Laura Trasante. Cuatro hijos.
Aspiraciones: «Ser una persona completa».
Aficiones: Viajar, Naturaleza y deporte.
Le agrada: La sinceridad. «Las personas con la cabeza llena, que tienen empatía y que saben comunicar».
Le disgusta: La incompetencia y la vanidad. «Me molestan la mentira y la gente que se disfraza todos los días».
Idiomas: Inglés.
Creencias: Agnóstico. «Sé que existe algo que no somos capaces de entender. Tengo un gran respeto por las religiones, pero no por la ignorancia tan supina que nos desborda».
Breve historial: .Hijo de militar, durante todo el Bachiller tenía asumido que seguiría los pasos de su padre. Pero fue su propio progenitor quien le liberó del compromiso. Se decidió por la Medicina, aprobó el MIR a la primera y no ha parado de asistir a cursos, congresos, conferencias e investigar (se doctoró 'cum laude' con una tesis sobre el buceo), dar docencia (profesor asociado de la Universidad de Murcia, y en el Centro de Buceo de la Armada) y trabaja en tres hospitales (Santa Lucía, La Vega Y Mesa del Castillo) y en su clínica, que es su mayor ilusión ya que nació de la nada y ahora es un referente en muchos campos como los implantes de oído, la coblación, la patología del buceo, vértigo y equilibrio, trastornos de la voz, del ronquido, problemas estéticos de nariz y oído y hasta tratamientos para dar a la piel un aspecto más joven. Por todo ello se considera una persona con mucha suerte: «Tengo una familia maravillosa, empezando por mi mujer, que es el pilar de mi vida, mis hijos, mis hermanos, mis padres, a los que les debo todo, mis suegros y, además, no me caben los amigos». Cree que en la sociedad española hay una falta de valores enorme. «Todo el mundo quiere conseguir objetivos materiales, pensando que les van a proporcionar la felicidad. No hay respeto por el prójimo. Quieren derechos sin obligaciones. El esfuerzo murió».
«Hoy no hay excusa para decirle a un paciente que no podrá oír nunca»
Pionero en la Región de Murcia en modernos implantes para recuperar el oído y reconocido como médico de referencia para aplicar la tecnología de coblación (una técnica que combina energía de alta frecuencia y soluciones salinas para remover tejidos blandos de forma mínimamente invasiva, que él emplea para operar de anginas) la trayectoria vital del otorrinolaringólogo Félix Díaz Caparrós no se ha caracterizado por ser súbdito de la sociedad del consumo y del entretenimiento que sigue engulléndonos, a pesar de la crisis económica. Muy al contrario, en vez de mirar hacia fuera escuchó sus voces internas, desoyó las que le hablaban de comodidad o de miedo, es decir ordenó su interior, y se puso a la tarea. El resultado es la personificación de un profesional inquieto, que no se conforma con ser testigo pasivo. Adjunto al área de Otorrinolaringología en el Hospital Universitario de Santa Lucía, Félix Díaz desea que la Sanidad Pública también se ocupe de la formación de sus facultativos.
-¿Mediante ayuda económica?
-No tiene porqué ser económica, pero sí en días que permitieran estudiar e investigar. Mi actividad en el hospital casi se ha convertido solo en consulta y quirófano. No tienes tiempo para dedicarlo a la formación.
-No parece ser su caso, pionero en implantes de avanzadas técnicas.
-El médico que tiene inquietud casi tiene que costearse su formación, aprovechando vacaciones y pagándose los cursos que merecen la pena. La Sanidad Pública -a la cual yo defiendo rotundamente- tiene que cambiar en varios aspectos y uno de ellos es la evaluación de sus profesionales. Es importantísimo: el médico que tiene una plaza en propiedad tiene que ser evaluado. Ya se hace en muchos países.
-¿Una especie de evaluación continua?
-Continua, sí. ¿Para qué? Para saber en qué se forma, qué investiga, cuáles son los resultados que obtiene. No sería lógico que estuviera operando siempre de la misma manera sin evolucionar en técnicas.
-Tal vez la estructura sanitaria pública sea demasiado funcionarial.
-El concepto de Medicina actual, desde mi punto de vista, está completamente equivocado. La Medicina se ha convertido en la superespecialización del médico y en tratar al paciente por partes. El futuro de la Medicina será la prevención, sin lugar a dudas. Pero al paciente hay que tratarlo de forma globalizada. No puede ser que tengas un problema de retina, por ejemplo, te den cita para no sé cuándo (las listas de espera son enormes) y a lo mejor el problema de la retina es diabético. Hay que ver el conjunto de su patología.
-El que hace esa función es el médico de cabecera ¿no?
-El médico de cabecera y el de Medicina Interna a nivel de hospital son, digamos, los encargados de ver un poquito global al paciente, pero el resto se ha perdido. Está muy compartimentada la asistencia médica.
-¿Y qué solución le ve?
-Soy partidario de la evaluación continua y de la motivación económica del profesional.
-¿Más gasto ahora que están recortando?
-Habría que hacer ajustes. En vez de que la Medicina pública sea siempre deficitaria, se podía utilizar sus recursos, como se hace en Francia, para tratar pacientes de compañías privadas y con ese dinero hacer más rentable, pero tiene que cambiar el concepto de asistencia. De hecho una de las cosas más bonitas que hay en la Medicina y que hoy día se ha perdido era que los médicos de 50, el ojo clínico. Muchísimas enfermedades se diagnosticaban sin necesidad de ninguna prueba, viendo solo al paciente, la piel, el oído, la vista&hellip.. Ahora van directamente a la prueba. Un escáner, una analítica, una resonancia y nadie te pregunta si los escáner que has pedido están justificados o no.
[Habla de forma pausada y con cierta entonación docente. Todo parece tenerlo planificado, pero no por motivos que tengan que ver con la seguridad de la rutina, sino por método y, en cuanto a su permanente objetivo de 'estar al día' no le importa convivir con la incertidumbre: entrena los músculos de la confianza y de la decisión para acometer nuevas metas. Fue precisamente el músculo del coraje el que le condujo a entrar en contacto con las firmas especializadas en novísimos implantes auditivos que él fue el primero en aplicar en la Región de Murcia.]
-¿Qué investiga en la actualidad?
-Estoy dirigiendo un máster a una fisioterapeuta alemana que está haciendo un estudio del ruido del oído (acufenos) relacionado con la osteopatía craneal, estudiamos también las causas de las hipoacusias bruscas, las personas que de golpe dejan de oír por un oído.
-¿Ya tienen algún resultado?
-De momento el estudio aporta que el estrés es un factor fundamental para estas hipoacusias bruscas, que ahora mismo es una incidencia muy grande en la sociedad.
[Lleva otra línea de estudio: un tratamiento muy novedoso, surgido en Alemania, aplicable a los pacientes que tienen problemas de ventilación del oído. «Hasta ahora no se podía mucho más que abrir el tímpano y colocar un tubito, ahora ha tenemos el balón Bielefeld». Es un tratamiento de dolencias auditivas mediante ventilación y el doctor Díaz es uno de los otorrinos españoles y el único de la Región de Murcia que lo está aplicando.]
-¿Qué le motiva?
-El paciente. No conformarse con que llegue un paciente que diga que tiene ruidos en el oído y responderle que eso es para toda la vida y enviarlo a que se compre un audífono. El médico debe ser honrado con el enfermo y estar formado para poder darle esperanza de que se cure, sin engañarlo, claro. De cara al futuro los implantes son una solución pasajera y sé que dentro de equis años todo se curará con terapia genética, con células madre. Pero mientras eso llega, también es verdad que hoy ya no hay excusa para decirle a una persona que no puede oír nunca.

Fuente: http://www.laverdad.es/murcia/v/20111126/region/medico-deberia-estar-obligado-20111126.html

Evaluation of the efficacy of caffeine cessation, nortriptyline, and topiramate therapy in vestibular migraine and complex dizziness of unknown etiology☆

2011-11-28T09:17:00.000-08:00

Evaluation of the efficacy of caffeine cessation, nortriptyline, and topiramate therapy in vestibular migraine and complex dizziness of unknown etiology☆

Anthony A. Mikulec MDa, b, Corresponding Author Contact Information, E-mail The Corresponding Author, Farhoud Faraji BAa, Laurence J. Kinsella MDa, c
a Saint Louis University School of Medicine, St. Louis, MO, USA
b Department of Otolaryngology, Saint Louis University School of Medicine, St. Louis, MO, USA
c Department of Neurology, Saint Louis University School of Medicine, St. Louis, MO, USA

Received 31 January 2011; Available online 24 June 2011.
Abstract
Objective

The aim of this study was to evaluate the efficacy of a therapeutic pathway for vestibular migraine (VM) and complex dizziness of undetermined etiology (CDUE) with caffeine cessation and pharmacotherapy.
Study Design

This study is a retrospective chart review.
Intervention(s)

Patients were recommended to stop intake of caffeine and other putative migraine-triggering agents. Pharmacotherapy was initiated with nortriptyline or topiramate if symptoms persisted despite diet modification.
Main Outcome Measure

Self-reported dizziness is the main outcome measure.
Results

Vestibular migraine and CDUE were considered contributing factors to dizziness in 34 and 10, respectively, of 156 patients. Fourteen percent of patients reported improvement in symptoms upon caffeine cessation, whereas 46% of patients reported a reduction in dizziness after nortriptyline therapy (P = .007). Topiramate reduced symptoms in 25% of patients. In total, 75% of VM patients and 56% of patients with CDUE received sufficient benefit from this therapeutic pathway to not progress to other treatments.
Conclusions

Vestibular migraine and CDUE can be treated effectively with a therapeutic pathway consisting of caffeine cessation followed by pharmacotherapy.
Article Outline

1. Introduction
2. Materials and methods
3. Results and analysis
4. Discussion
5. Conclusion
References

1. Introduction

A portion of patients presenting to dizziness clinics have symptoms that may be attributed to vestibular migraine (VM). Vestibular migraine, also known as migrainous vertigo and migraine-associated dizziness, is a migraine variant for which specific diagnostic criteria have been proposed [1]. However, VM has not been officially recognized by the International Headache Society as a migraine variant [2]. As a result, this lack of recognition may act as a contributing factor to a subset of patients with dizziness escaping categorization despite a thorough evaluation. In our practice, we describe another subset of patients as having “complex dizziness of unknown etiology” (CDUE)—those patients who do not have an underlying cause for their dizziness identified despite evaluation by both a neuro-otologist and neurologist specializing in dizziness. We have chosen to initially treat patients with CDUE equivalently to those with VM under the rationale that, because migraine is relatively common and VM is ill defined, it is possible that patients with CDUE may have a migraine variant as a cause of their dizziness.

Various treatments, including diet therapy, have been reported for VM [3]. Some patients with migraine, be it VM or other variants, appear to have dietary or environmental triggers, and avoiding such triggers can result in relief of symptoms. Both the use of caffeine and caffeine withdrawal have been suggested to be triggers of migraine for some patients, yet caffeine is a component of over-the-counter migraine medications and has also been used in clinical trials as a therapy against migraines [4], [5], [6], [7], [8] and [9]. In an effort to resolve the ambiguity currently in the literature regarding the role of caffeine in migraine and to identify an effective method to treat patients with VM and CDUE, the authors retrospectively reviewed the records of patients presenting to the clinic with the primary complaint of dizziness to evaluate the efficacy of a therapeutic pathway to VM and CDUE with long-term caffeine cessation as a first step and pharmacotherapy with nortriptyline or topiramate as the second step.
2. Materials and methods

In this retrospective study, the records of 156 consecutive patients seen at a tertiary combined dizziness clinic by a neurologist and a neurotologist from 2005 to 2009 were reviewed. The records of patients who had reported caffeine intake and caffeine cessation, had undergone treatment with topiramate or nortriptyline, or had been diagnosed with VM or CDUE were selected and examined in detail. All patients diagnosed with CDUE had undergone thorough evaluation, including assessment for vestibular, neurologic, autonomic, and cardiac dysfunction as an underlying cause of dizziness.

This study was initiated with the purpose of assessing the prevalence of VM and the average quantity of caffeine consumption in our combined dizziness clinic, as well as to evaluate the efficacy of caffeine cessation, treatment with nortriptyline, and treatment with topiramate in patients with VM and CDUE. The caffeine concentrations used in this study were acquired either from company Web sites or by direct inquiry from the company and rounded to the nearest multiple of 5. The values for these calculations are listed in Table 1.
Table 1. Caffeine standards
Beverage Volume (oz) Caffeine (mg)
Generic brewed coffee 12 200
Decaffeinated generic coffee 12 15
Diet Coca Cola 12 50
Coca Cola Classic 12 35
Pepsi and Diet Pepsi 12 40
Dr Pepper and Diet Dr Pepper 12 40
Mountain Dew 12 55
Tea, brewed 12 75
Decaffeinated tea Negligible
Summary of the standard concentrations used to calculate patient daily caffeine intake.

Pharmacotherapy was initiated if patients continued to complain of dizziness symptoms after 4 to 6 weeks of caffeine cessation and diet modification. Nortriptyline was prescribed in an escalating fashion, starting with a dose of 25 mg nightly for 2 weeks, then escalating to 50 mg nightly for 2 weeks, and then finally escalating to 75 mg nightly. Patients were recommended to maintain the lower dose of 25 or 50 mg if they received sufficient benefit at that dose. Topiramate therapy was initiated at 25 mg twice daily and occasionally increased to 50 mg twice daily based on patient tolerance and preference. Drug selection was based on cost, side-effect profile, interactions with other patient medications, and familiarity of the prescribing physician with the medication. The Saint Louis University Institutional Review Board approved this study.

Statistical analysis was conducted using a 2-tailed Fisher exact test with the GraphPad QuickCalc online statistical tool: http://www.graphpad.com/quickcalcs/contingency1.cfm (accessed November 2010).
3. Results and analysis

Of the 156 charts reviewed, a total of 57 patients were suspected of VM, had reported caffeine intake and cessation results, or had been treated with topiramate or nortriptyline. This group ranged in age from 22 to 85 years, with a median age of 45 years, and was composed of 23% men and 77% women. For further analysis, the group was divided into patients with definite or probable VM and those with complex dizziness of unclear etiology (CDUE).

Based on vestibular testing and patient history, VM was considered a contributing factor to dizziness in 41 patients. The median age of the VM group was 44 years, ranged from 22 to 68 years, and was composed of 22% men and 78% women. These patients met the Neuhauser criteria for probable VM as described in Table 2[1]. Thus, probable VM had a prevalence of 26% at our tertiary dizziness clinic. The retrospective nature of this study precluded the authors to diagnose definite VM with certainty.
Table 2. Diagnostic criteria for definite and probable VM
Definite VM
• Episodic vestibular symptoms of at least moderate severity
• Current or previous history of migraine according to the 2004 criteria of the International Headache Society (IHS)
• One of the following migrainous symptoms during 2 or more attacks of vertigo: migrainous headache, photophobia, phonophobia, visual aura, or other aura
• Other causes ruled out by appropriate investigations
Probable VM
• Episodic vestibular symptoms of at least moderate severity
• One of the following:
(1) current or previous history of migraine according to the 2004 criteria of the HIS;
(2) migrainous symptoms during vestibular symptoms;
(3) migraine precipitants of vertigo in more than 50% of attacks: food triggers, sleep irregularities, or hormonal change; or
(4) response to migraine medications in more than 50% of attacks
• Other causes ruled out by appropriate investigations
Comment: Vestibular symptoms are rotational vertigo or another illusory self- or object motion. They may be spontaneous or positional. Vestibular symptoms are “moderate” if they interfere with but do not prohibit daily activities and “severe” if patients cannot continue daily activities.Adapted from Neuhauser and Lempert [1].

Sixteen patients were diagnosed with CDUE. Patients included in the CDUE group presented with an amalgamation of poorly defined symptoms defying easy categorization. Some patients reported symptoms consistent with episodic vertigo, some reported symptoms of disequilibrium without vertigo, others reported more vague sensations such fogginess or instability, and yet others reported a combination of the aforementioned symptoms. The age range in this group was 25 to 85 years, with median age of 58 years. The CDUE group was composed of 31% men and 69% women. Fig. 1 and Fig. 2 outline the therapeutic pathway used to treat patients with VM and CDUE, respectively.

Full-size image (50K) - Opens new windowFull-size image (50K)
High-quality image (380K)

Fig. 1.

This decision tree illustrates the therapeutic pathway for patients in the vestibular migraine group.

Full-size image (14K) - Opens new windowFull-size image (14K)
High-quality image (110K)

Fig. 2.

This decision tree illustrates the therapeutic pathway for patients in the complex dizziness of unclear etiology group.

Of the 57 patients, 34 in the VM group and 10 in the CDUE group had caffeine intake records specific enough to quantify by estimation. The mean caffeine intake for all patients was 320 ± 270 mg/day and ranged from 40 to 1200 mg/day. Caffeine intake in the VM group ranged from 50 to 850 mg/day, with a mean intake of 275 ± 215 mg/day. The CDUE group had caffeine intake in the range of 40 to 1200 mg/day, with a mean intake of 440 ± 360 mg/day. Vestibular migraine and CDUE groups did not differ significantly in caffeine intake. Data on patient age, sex, and caffeine intake are stratified into VM and CDUE groups and summarized in Table 3.
Table 3. Summary of patient age, sex, and caffeine intake
Age (y), median (range) Sex (M:F) Caffeine intake (mg/d), mean (range)
Overall 45 (22–85) 23:77 320 (40–1200)
VM 44 (22–68) 22:78 275 (50–850)
CDUE 58 (25–85) 31:69 440 (40–1200)

Cessation effective 40 (33–68) 17:83 200 (50–300)
The row entitled “Cessation effective” specifies the characteristics of patients who reported at least a partial reduction in dizziness symptoms after caffeine cessation and diet modification.

All patients who reported caffeine intake and consumption of other putative migraine precipitants—including aged cheeses and monosodium glutamate—were recommended to completely discontinue all intake of migraine precipitants, especially caffeine. Overall, 14% of patients reported any reduction in symptoms of dizziness or headache upon caffeine cessation. In the VM group, 5 (15%) of the 34 patients who had caffeine intake on record reported any benefit from caffeine cessation. In the CDUE group, 1 patient (10%) reported a reduction in symptoms upon caffeine cessation (Table 4). No significant difference was noted between the efficacy of caffeine cessation between VM and CDUE groups. The caffeine intake in the 6 patients who improved upon caffeine cessation ranged from 50 to 300 mg/day, with an average of 200 ± 85 mg/day. It should be noted that most patients who reported a benefit from caffeine cessation did not find caffeine cessation alone as sufficient relief from dizziness symptoms. In fact, only 1 patient received sufficient relief from caffeine cessation and diet modification to decline pharmacologic intervention. Because this patient was part of the CDUE group, the progression-free benefit rate of caffeine cessation is 10% in the CDUE group and 2.3% overall in this study. Most patients who attempted caffeine cessation and dietary modification went on to be prescribed either nortriptyline or topiramate. Dosage regimens for both drugs are detailed in “Materials and methods.”
Table 4. Efficacy of caffeine cessation, nortriptyline therapy, and topiramate therapy
Caffeine cessation Total (n = 44) VM (n = 32) CDUE (n = 10)
Effective 6 (14%) 5 (15%) 1 (10%)
Not effective 38 (86%) 29 (85%) 9 (90%)

Nortriptyline Total (n = 24) VM (n = 17) CDUE (n = 7)
Effective 11 (46%) 8 (47%) 3 (43%)
Not effective 13 (54%) 9 (53%) 4 (57%)

Nortriptyline in caffeine cessation nonresponders Total (n = 21) VM (n = 14) CDUE (n = 7)
Effective 11 (52%) 8 (57%) 3 (43%)
Not effective 10 (48%) 6 (43%) 4 (57%)

Topiramate VM (n = 16)
Effective 4 (25%)
Not effective 12 (75%)

Topiramate in caffeine cessation nonresponders VM (n = 6)
Effective 1 (17%)
Not effective 5 (83%)
Summary of patients who reported results of caffeine cessation, nortriptyline, and/or topiramate therapy. Results have been reported for all patients (total), the VM group (VM), and the complex dizziness of unclear etiology group (CDUE). For patients who underwent pharmacotherapy with either agent, results of the efficacy of pharmacotherapy are reported for all patients and for those who reported no benefit from caffeine cessation. Only patients in the VM group were treated with topiramate.

Nortriptyline was prescribed to a total of 30 VM and CDUE patients with the primary intention of alleviating dizziness symptoms. The patients whose response to treatment could not be found in their records are summarized as “Unknown Result” and are not included in the efficacy analysis. Six such patients were treated with nortriptyline; thus, only 24 patients were included in the analysis. Eleven (46%) patients reported a reduction in dizziness after therapy with nortriptyline, which was a statistically significant difference relative to caffeine cessation and diet modification (P = .007). Fig. 3 compares the efficacy of caffeine cessation, nortriptyline therapy, and pharmacotherapy with either nortriptyline or topiramate. Nortriptyline improved the symptoms of 8 (47%) patients in the VM group and 3 (43%) patients in the CDUE group (Table 4).

Full-size image (10K) - Opens new windowFull-size image (10K)
High-quality image (81K)

Fig. 3.

The efficacy of caffeine cessation vs pharmacotherapy. The pharmacotherapy columns represent combined nortriptyline or topiramate efficacy results. Combined data from VM and CDUE groups are shown.

Included in the 13 (54%) patients who received no benefit from nortriptyline therapy are 2 patients who were unable to tolerate the adverse effects and thus discontinued nortriptyline (Table 5). One patient showed a temporary reduction of symptoms but subsequently developed refractoriness to the drug. Nortriptyline worsened the symptoms of 1 patient, was not tolerated by 2 patients, and became refractory in 1 patient. For the purposes of the analysis, nortriptyline was deemed not effective in all of these patients.
Table 5. Comparison of tolerability and the development of refractoriness of nortriptyline and topiramate
Unable to tolerate Developed refractoriness to effects
Nortriptyline 2/24 (8%) 1/24 (4%)
Topiramate 1/16 (6%) 3/16 (19%)

Nortriptyline was administered to 21 patients who did not respond to caffeine cessation. It reduced dizziness in 11 (52%) of these patients (Table 4).

Topiramate was administered to 16 patients, all of whom were diagnosed with probable VM. It proved effective in reducing dizziness and headache in 4 (25%) patients (Table 4). One (6%) patient discontinued topiramate due to the adverse effects, 3 (19%) patients developed refractoriness to the drug, and 1 patient whose symptoms were improved by discontinuing topiramate were all included in the not effective group. Table 5 depicts a comparison of the tolerability and development of refractoriness of nortriptyline and topiramate. Because patients only in the VM group were treated with topiramate, Fig. 4 compares the efficacy of topiramate, nortriptyline, and caffeine cessation therapy in VM patients. The difference between the efficacy of topiramate and that of caffeine cessation was not statistically significant.

Full-size image (23K) - Opens new windowFull-size image (23K)
High-quality image (117K)

Fig. 4.

Caffeine cessation vs topiramate vs nortriptyline in patients with VM.

Six patients who did not respond to caffeine cessation were administered topiramate. Topiramate was effective in 1 (17%) patient. Topiramate was ineffective in 1 patient and was refractory in 2 patients, and 2 patients discontinued use because of their inability to tolerate the adverse effects, all of whom were counted in the not effective group (Table 4). As shown in Fig. 5, the difference between the efficacies of nortriptyline therapy vs topiramate therapy in caffeine cessation nonresponders was not statistically significant.

Full-size image (19K) - Opens new windowFull-size image (19K)
High-quality image (78K)

Fig. 5.

Topiramate vs nortriptyline in caffeine cessation nonresponders.

Overall, 75% (12/16) of the patients with VM and 56% (5/9) of the patients with CDUE who completed the therapeutic pathway received sufficient benefit from it to not progress on to other treatments.
4. Discussion

Various treatments for VM have been described including physical therapy [10], diet therapy [3] and [11], and prophylactic pharmacologic therapies [12] and [13]. The drug of choice for VM has not been standardized, with selection of medication, as in this study, often determined by physician familiarity and preference. Generally, the pharmacologic treatment of VM involves trial and error of various medications. In this retrospective study, we evaluated the efficacy of a therapeutic pathway for the treatment of VM and CDUE wherein the first step for patients who reported caffeine intake, as assessed by questionnaire, was discontinuation of caffeine. Patients without a significant caffeine intake and those who failed caffeine cessation were then treated with prophylactic pharmacologic therapy with either nortriptyline or topiramate. The choice between the 2 drugs was not based on the patient's symptom complex, but rather on ancillary characteristics such as cost, side-effect profile, interactions with other patient medications, and familiarity of the prescribing physician with the medication (A.A.M. being more familiar with nortriptyline and L.J.K. being more familiar with topiramate). Overall, 75% (12/16) of the patients with VM and 56% (5/9) of the patients with CDUE who completed the pathway received sufficient benefit from it to not progress on to other treatments.

In this study, 14% of patients received at least some reduction in dizziness symptoms with caffeine cessation and diet modification alone. However, many of these patients did not find caffeine cessation and diet modification alone as sufficient relief from their dizziness symptoms. The approximate amount of caffeine present in various beverages is shown in Table 1. It should be noted that those who responded to caffeine cessation tended to have moderate, rather than extreme, caffeine intakes, suggesting that physicians could reasonably recommend caffeine cessation for these patients and not only for those who have very high caffeine intake.

The success of diet therapy for VM has been previously reported [3]. Although we recommended avoidance of many known dietary triggers of migraine, our study focused, in particular, on caffeine cessation under the rationale that expecting Americans to transition abruptly to a completely migraine friendly diet free of MSG, preservatives, and all other migraine triggers was unrealistic. Not all patients were treated with caffeine cessation because they already exhibited little or no caffeine intake. Although only a low percentage of patients responded to caffeine cessation, we feel that caffeine cessation and diet modification should be the first step in treatment of patients with VM or CDUE. It remains unclear what level of caffeine intake, if any, is acceptable for patients with VM. The allowable amount may well be none.

Nortriptyline has been previously described in the treatment of VM [13]. Adverse effects of nortriptyline include somnolence, which is why the medication was prescribed to be taken at night. Care must also be taken when prescribing this medication to women of childbearing age because both nortriptyline and topiramate are listed category C agents in pregnancy [14]. Other common adverse effects included weight gain and sexual dysfunction [15]. In this study, the success rate of treating VM with nortriptyline as initial or secondary pharmacologic management was 46%, a statistically significant improvement in symptoms relative to caffeine cessation and diet modification.

Topiramate has also been used in the treatment of VM alone [11], in children [16] and in combination with amitriptyline, an analog of nortriptyline, in the treatment of migraine in general [17], [18] and [19]. Topiramate has shown to be efficacious for general migraine prophylaxis [19] and [20]. In this study, the success rate of treating patients with VM with topiramate, either as initial pharmacologic therapy or after nortriptyline failure, was 25%.

Few studies of CDUE exist because this is, by definition, a cryptic category. Some patients with CDUE may experience a yet undescribed underlying cause of dizziness. Given the known heterogeneity of migraine presentation and the high prevalence of migraine, it is reasonable to deduce that some patients who do not fit the criteria of probable or definite VM as defined by Lempert and Neuhauser [21] may, in fact, have migraine. The fact that patients with CDUE were less likely than patients with VM to respond to caffeine cessation or treatment with nortriptyline or topiramate suggests that patients with CDUE are either less likely to have migraine as an underlying pathology or have a variant of migraine that is less responsive to these 2 medications than VM. We have included the category of CDUE in this study to demonstrate that it can, in some cases, be successfully treated with antimigraine medications.

Limitations of this study include its retrospective nature, lack of randomization, and relatively small number of patients. Nonetheless, despite the relatively small sample size, statistical significance was achieved in some analyses, and other analyses may approach significance in larger patient populations, supporting the pursuit of larger scale, prospective, controlled, randomized clinical trials to validate this therapeutic pathway. Like all studies regarding VM, ours suffers from the lack of a firm and accepted definition of the entity in question. Because the choice of initial pharmacologic prophylactic therapy is, as in this study, often somewhat arbitrary, and clear data regarding efficacy are lacking, prospective randomized trials comparing various medications would be of great value to the field. We feel that nortriptyline and topiramate represent 2 medications worthy of further analysis in the treatment of VM.
5. Conclusion

Vestibular migraine and CDUE can be treated with a therapeutic pathway, with caffeine cessation being a reasonable first step. The ideal pharmacologic intervention for VM remains to be determined. Patients with dizziness of unknown cause may reasonably be treated with the same medications used for VM.
References

[1] H. Neuhauser and T. Lempert, Vestibular migraine. Neurol Clin, 27 (2009), pp. 379–391. Article | PDF (164 K) | | View Record in Scopus | | Cited By in Scopus (13)

[2] J. Olesen, The International Classification of Headache Disorders. 2nd edition (ICHD-II). Rev Neurol (Paris), 161 (2005), pp. 689–691. Article | PDF (45 K) | | View Record in Scopus | | Cited By in Scopus (11)

[3] M.D. Reploeg and J.A. Goebel, Migraine-associated dizziness: patient characteristics and management options. Otol Neurotol, 23 (2002), pp. 364–371. | View Record in Scopus | | Cited By in Scopus (58)

[4] C. Wöber and C. Wöber-Bingöl, Triggers of migraine and tension-type headache. Handb Clin Neurol, 97 (2010), pp. 161–172. Article | PDF (187 K) | | View Record in Scopus | | Cited By in Scopus (5)

[5] C. Sun-Edelstein and A. Mauskop, Foods and supplements in the management of migraine headaches. Clin J Pain, 25 (2009), pp. 446–452. | View Record in Scopus | | Cited By in Scopus (10)

[6] J.G. Millichap and M.M. Yee, The diet factor in pediatric and adolescent migraine. Pediatr Neurol, 28 (2003), pp. 9–15. Article | PDF (72 K) | | View Record in Scopus | | Cited By in Scopus (59)

[7] M. Aguggia and M.G. Saracco, Pathophysiology of migraine chronification. Neurol Sci, 31 Suppl 1 (2010), pp. S15–S17.

[8] L.L. Mueller, Diagnosing and managing migraine headache. J Am Osteopath Assoc, 107 10 Suppl 6 (2007), pp. ES10–ES16.

[9] J. Goldstein, S.D. Silberstein and J.R. Saper, et al. Acetaminophen, aspirin, and caffeine versus sumatriptan succinate in the early treatment of migraine: results from the ASSET trial. Headache, 45 (2005), pp. 973–982. | View Record in Scopus | | Cited By in Scopus (41)

[10] S.L. Whitney, D.M. Wrisley and K.E. Brown, et al. Physical therapy for migraine-related vestibulopathy and vestibular dysfunction with history of migraine. Laryngoscope, 110 (2000), pp. 1528–1534. | View Record in Scopus | | Cited By in Scopus (53)

[11] B. Baier, E. Winkenwerder and M. Dieterich, “Vestibular migraine”: effects of prophylactic therapy with various drugs. A retrospective study. J Neurol, 256 (2009), pp. 436–442. | View Record in Scopus | | Cited By in Scopus (10)

[12] P. Bikhazi, C. Jackson and M.J. Ruckenstein, Efficacy of antimigrainous therapy in the treatment of migraine-associated dizziness. Am J Otolaryngol, 18 (1997), pp. 350–354.

[13] M. Fotuhi, B. Glaun and S.Y. Quan, et al. Vestibular migraine: a critical review of treatment trials. J Neurol, 256 (2009), pp. 711–716.

[14] G.G. Briggs, R.K. Freeman and S.J. Yaffe, Drugs in pregnancy and lactation: a reference guide to fetal and neonatal risk, (8th ed.), Lippincott Williams & Wilkins, Philadelphia (Pa) (2008).

[15] M.H. Beers, R.S. Porter and T.V. Jones, The Merck Manual of Diagnosis and Therapy, (8th ed.), Merck Publishing Group, Rahway (NJ) (2006).

[16] D. Lewis and E. Paradiso, A double-blind, dose comparison study of topiramate for prophylaxis of basilar-type migraine in children: a pilot study. Headache, 47 (2007), pp. 1409–1417.

[17] D.W. Dodick, F. Freitag and J. Banks, et al. Topiramate versus amitriptyline in migraine prevention: a 26-week, multicenter, randomized, double-blind, double-dummy, parallel-group noninferiority trial in adult migraineurs. Clin Ther, 31 (2009), pp. 542–559.

[18] K. Keskinbora and I. Aydinli, A double-blind randomized controlled trial of topiramate and amitriptyline either alone or in combination for the prevention of migraine. Clin Neurol Neurosurg, 110 (2008), pp. 979–984.

[19] L. Edvinsson and M. Linde, New drugs in migraine treatment and prophylaxis: telcagepant and topiramate, . Lancet, 376 (2010), pp. 645–655 [Epub 2010 Apr 21].

[20] D. D'Amico, Pharmacological prophylaxis of chronic migraine: a review of double-blind placebo-controlled trials. Neurol Sci, 31 Suppl 1 (2010), pp. S23–S28.

[21] T. Lempert and H. Neuhauser, Epidemiology of vertigo, migraine and vestibular migraine. J Neurol, 256 (2009), pp. 333–338. | View Record in Scopus | | Cited By in Scopus (25)

☆Declarations: 1. Each of the authors has contributed to read and approved this manuscript. 2. None of the authors has any conflict of interest, financial or otherwise. 3. This manuscript, or any part of it, has not been previously published; nor is it under consideration for publication elsewhere. In consideration of the American Journal of Otalaryngology's reviewing and editing my submission, “Evaluation of the Efficacy of Caffeine Cessation, Nortriptyline, and Topiramate in the Treatment of Vestibular Migraine and Complex Dizziness of Unknown Etiology,” the authors undersigned transfers, assigns, and otherwise conveys all copyright ownership to Elsevier Inc. In the event that such work is published in the American Journal of Otolaryngology.

Corresponding Author Contact InformationCorresponding author. 3635 Vista Avenue, 6FDT, St. Louis, MO 63110, USA.

Fuente: American Journal of Otolaryngology
Volume 33, Issue 1, January-February 2012, Pages 121-127

Association of prepro-orexin polymorphism with obstructive sleep apnea/hypopnea syndrome☆

2011-11-28T09:11:00.000-08:00

Original contribution

Weihu Chen MD1, a, Jingying Ye MD1, a, Demin Han MD, PhDCorresponding Author Contact Information, a, E-mail The Corresponding Author, Guoping Yin MDa, Boxuan Wang MSa, Yuhuan Zhanga
a Department of Otorhinolaryngology, Head and Neck Surgery, Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, Beijing, China

Received 23 October 2010; Available online 2 March 2011.
Abstract
Background

Because of the potential role of orexin neuronal circuitry in the regulation of sleep and wakefulness and arousal and breathing, it seems reasonable to speculate that abnormalities in the prepro-orexin gene could be relevant to studies of obstructive sleep apnea/hypopnea syndrome (OSAHS); and it might be a candidate gene in the pathogenesis of OSAHS.
Objective

The present study investigated whether single nucleotide polymorphisms (SNPs) in the human prepro-orexin gene are associated with OSAHS in Han Chinese people.
Methods

A total of 394 subjects (217 cases and 177 control subjects) were recruited from China. Diagnostic polysomnography was performed in all patients and control subjects. SNPs in potentially functional regions of the gene were identified; and genotypes, determined by direct sequencing.
Results

By sequencing the promoter, 2 exons, and the exon-intron junctions of the prepro-orexin gene, the g11182C>T SNP was identified. Statistical analysis showed that there were significant differences in the genotype distribution between patients with OSAHS and the control group (χ22 = 6.437, P = .04). Variant allele T of the g1182C>T polymorphism was more commonly found in patients with OSAHS as compared with control subjects (χ21 = 5.648, P = .017; odds ratio, 1.449; 95% confidence interval, 1.0466–1.968).
Conclusions

Our results suggest that the prepro-orexin gene polymorphism g1182C>T is associated with susceptibility to OSAHS in Han Chinese. This study provides insights into the genetic information for future studies regarding this gene in OSAHS.
Article Outline

1. Introduction
2. Methods
2.1. Patients
2.2. Polysomnography
2.3. Prepro-orexin gene screening
2.4. Statistical analysis
3. Results
3.1. Characteristics and PSG data of subjects
3.2. Frequencies of genotypes and alleles of the polymorphism in patients with OSAHS and control subjects
3.3. Frequencies of genotypes between subgroups classified by BMI
4. Discussion
Acknowledgments
References

1. Introduction

Obstructive sleep apnea/hypopnea syndrome (OSAHS) is a highly prevalent disorder with multiple comorbidities. Overt sleep apnea has been estimated to affect 2% of middle-aged women and 4% of middle-aged men, at least 1% of preschool children, and at least 11% of the elderly [1], [2] and [3]. Its etiology is complex and multifactorial, with evidence that susceptibility is influenced by risk factors that include obesity and obesity-associated traits, craniofacial characteristics associated with reduced upper airway dimensions, as well as ventilatory deficits that predispose to pharyngeal collapsibility during sleep, when neuromuscular output is either reduced or relatively unstable. Although studies of the genetic etiology of the disorder are few, there are growing data that have quantified the heritability of OSAHS, described potential modes of transmission, and have identified suggestive and/or biologically plausible candidate genes [4], [5], [6] and [7].

The excitatory neuropeptide orexin (or hypocretin) is synthesized by neurons restricted to the lateral hypothalamus. Only 2 splice orexin variants (orexin A and orexin B) derived from a unique precursor have been identified, which bind 2 G-protein–coupled receptors (orexin 1 receptor and orexin 2 receptor) [8] and [9]. Orexin neuron projections target a large number of forebrain, limbic, and brainstem nuclei [10] and [11]; and, in turn, they receive inputs from numerous brain nuclei that govern interoceptive and homeostatic signals [12] and [13]. Orexin signaling is involved in the regulation of many neuronal circuits; the most prominent ones control feeding and energy homeostasis [14] and [15] as well as sleep-wake states [16] and [17]. Orexin signaling has also been implicated as regulator of autonomous processes such as emotion and cardiorespiratory functions [18] and [19]. In rodents, canines, and humans, orexin deficiency is associated with narcolepsy characterized by sleep attacks and sleep fragmentation [20].

Preliminary data suggest that orexin levels are abnormal in patients with OSAHS. In one study, morning orexin levels were significantly lower in patients with sleep apnea than in controls [21]. In a repeat study examining orexin levels later in the day, this difference persisted [22]. Another study found low orexin levels in patients with obstructive sleep apnea but also found that reduced orexin levels with obstructive sleep apnea did not correlate with body mass index (BMI), treatment with continuous positive airway pressure, or with daytime hypersomnolence [23]. These relationships suggest that orexin levels may not necessarily be a consequence of the syndrome but instead may be involved in the pathogenesis of obstructive sleep apnea.

It seems reasonable to speculate that abnormalities in the prepro-orexin gene could be relevant to studies of OSAHS because of the potential impact of these neuropeptides on arousal and muscle tone, both of which influence the behavior of respiratory systems, and/or because of the close proximity of these neurons to central respiratory control centers, with potential interactions between arousal and respiratory centers. Therefore, the present study investigated whether the single nucleotide polymorphisms (SNPs) in the human prepro-orexin gene are associated with OSAHS in Han Chinese people.
2. Methods
2.1. Patients

The study sample consisted of 217 patients with OSAHS (157 males and 60 females) diagnosed by using the overnight polysomnography (PSG). The patients who met the diagnostic criteria of OSAHS were recruited from the sleep laboratory of the Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, China. No patients were suspected of having narcolepsy, which is an incurable disorder characterized by excessive sleepiness that typically is associated with episodes of cataplexy. In patients with OSAHS, the mean ± SD age was 50.53 ± 8.57 years; apnea/hypopnea index (AHI), 53.9 ± 16.4 events/h; and BMI, 28.32 ± 4.62 kg/m2, respectively.

A total of 177 healthy control subjects (113 males and 64 females) were screened for a personal or family history to exclude sleep disorders. The mean ± SD age was 48.91 ± 9.45 years; and BMI, 25.17 ± 3.63 kg/m2 in the healthy control group. In these subjects, AHI had to be below 5/h as confirmed by PSG.

All subjects were unrelated Chinese Han individuals. Patients with OSAHS and healthy control subjects were screened to exclude definite psychiatric disorders (axis I disorders of the Diagnostic and Statistical Manual of Mental Disorders) and taking psychotropic medication regularly. General exclusion criteria were drugs influencing the central nervous system; sleep and heart condition; and diseases such as diabetes, acute or ischemic inflammatory liver diseases, thyroid diseases, and acute or chronic renal diseases.

The study was performed in accordance with the Declaration of Helsinki and was approved by the local ethics committee. Written informed consent was given by all participants.
2.2. Polysomnography

All patients with OSAHS and control subjects underwent overnight PSG. PSG consisted of a continuous polygraphic recording electroencephalography (C3/A2, C4/A1), electrooculogram, submental electromyography, right and left anterior tibialis surface electromyography, electrocardiogram, nasal and oral airflow, thoracic and abdominal movements, and oxyhemoglobin saturation. A tracheal microphone was used to detect snoring, and sensors were used to detect the position during sleep. PSG records were interpreted manually according to standard criteria. Apnea episodes were defined as complete cessation of airflow lasting at least 10 seconds. Hypopnea was defined as at least a 50% reduction in airflow for at least 10 seconds accompanied by a reduction in So2 of at least 4%. AHI was defined as the number of events of apnea or hypopnea per hour during sleep time, based on the results of the overnight PSG.
2.3. Prepro-orexin gene screening

The molecular analysis of the prepro-orexin gene was performed using genomic DNA obtained from the peripheral blood by conventional methods. Mutations in the promoter, 2 exons, and exon-intron junctions of prepro-orexin gene were screened by direct sequencing (GenBank accession no. AF118885). The detailed list of primers can be found in Table 1.
Table 1. Primer pairs used in PCRs conducted on prepro-orexin gene
Coding region Forward primer Reverse primer
5′UTR 5′TAGTGGAAAGGGCAGAAG 3′ 5′ATTGTGACCCACTCCCAGG 3′
Exon 1 5′ATCTTAGACTTGCCTTTGTCT 3′ 5′CAAACACAGGCTCTTAGC 3′
Exon 2 5′GGCGCAAAGCAAGGAGAACT3′ 5′GAGTTCCCAGTGCAAGGCCC3′
Nucleotide bases: A, adenine; C, cytosine; G, guanine; T, thymine.

Polymerase chain reaction (PCR) was carried out in a reaction buffer in a total volume of 25 μL, containing 50 ng of genomic DNA, 1 μL deoxyribonucleotide triphosphate, 1 μL proTaq DNA polymerase (Promega Corp, WI), and 0.5μL of each primer. The PCR was performed for 35 cycles of 94°C for 30 seconds, 60°C for 60 seconds, and 72°C for 45 seconds, with initial denaturation at 94°C for 5 minutes and a final extension at 72°C for 3 minutes (GeneAmp PCR System 9700; PE Applied Biosystems, CA). The PCR products were purified; then, sequencing was performed on an Applied Biosystems model 3730 automated sequencer (Applied Biosystems Corp, CA). Sequence data were compared with the published sequence of GenBank accession no. AF118885.
2.4. Statistical analysis

Descriptive characteristics of group variables are expressed as mean ± SD. The significance of variables between groups was tested by unpaired Student t test. Comparison of genotype and allele frequencies between the groups was subsequently carried out using Pearson χ2 test. In addition, the Cochran-Mantel-Haenszel χ2 statistic was used to test for the association of genotype with OSAHS after adjusting for the BMI. All tests were 2-tailed, and significance level was set at P < .05. The statistical analyses were performed using the program Statistical Package for the Social Sciences 16 (SPSS, Inc, Chicago, IL).3. Results3.1. Characteristics and PSG data of subjectsThe characteristics of 217 patients with OSAHS and 177 control subjects in overnight PSG are presented in Table 2. There were no significant differences in age and sex ratio between the 2 groups. Body mass index, AHI, nocturnal mean Sao2, and minimum Sao2 in control subjects were significantly different from the patients with OSAHS.Table 2. Characteristics and PSG data of patients with OSAHS and control subjectsCharacteristics OSAHS group (n = 217) Control group (n = 177) t PAge (y) 50.53 ± 8.57 48.91 ± 9.45 1.784 .075Sex⁎Male 157 113 χ2 = 3.272 .07Female 60 64 BMI (kg/m2) 28.32 ± 4.62 25.17 ± 3.63 −7.386 <.001AHI (events/h) 45.46 ± 30.12 1.89 ± 1.45 −19.211 <.001Mean So2 (%) 89.42 ± 4.32 95.33 ± 2.05 9.038 <.001Lowest Spo2 (%) 73.97 ± 14.52 91.09 ± 2.77 15.455 <.001Date are presented as mean ± SD.⁎ χ2 Analysis (2 × 2 contingency table).3.2. Frequencies of genotypes and alleles of the polymorphism in patients with OSAHS and control subjectsAn SNP g1182C>T was identified in the prepro-orexin exon 2. This was a cytosine (C)-thymine (T) SNP 349 base pairs downstream from the initiation of exon 2. Table 3 shows the distribution of the prepro-orexin g1182C>T polymorphism genotypes and alleles in 2 groups. Genotype frequencies of polymorphisms in either OSAHS or control groups were in Hardy-Weinberg equilibrium (P > .05), which suggested that the study sample came from a general population, without any effects of natural selection or migration. Statistical analysis showed that there were significant differences in the genotype distribution between patients with OSAHS and the control group (χ22 = 6.437, P = .04). Variant allele T of the g1182C>T polymorphism was more commonly found in patients with OSAHS as compared with control subjects (χ21 = 5.648; P = .017; odds ratio [OR], 1.449; 95% confidence interval, 1.0466–1.968).
Table 3. Frequencies of genotypes and alleles of the polymorphism in prepro-orexin gene in patients with OSAHS and control subjects
Genotype HWE P Allele
C/C C/T T/T C T
OSAHS (n = 217) 85 (39.2) 112 (51.6) 20 (9.2) .347 282 (65.0) 152 (35.0)
Control (n = 177) 91 (51.4) 76 (42.9) 10 (5.6) .709 258 (72.9) 96 (27.1)
χ2 6.437 5.648
P .04 .017
OR⁎ 1.449 (1.066–1.968)
Data are presented as n (%). χ2 Analysis (R × C contingency table). HWE indicates Hardy-Weinberg equilibrium.
⁎ OR: for the the T allele.
3.3. Frequencies of genotypes between subgroups classified by BMI

The standard Cochran-Mantel-Haenszel χ2 test was used to test for association between SNP and OSAHS in an attempt to control for differences in BMI between the 2 groups. All 394 subjects were classified into 2 subgroups according to a BMI cutoff point of 30 kg/m2: obese subjects (BMI, >30 kg/m2; n = 110) and nonobese subjects (BMI, <30 kg/m2; n = 284). Results of the analysis also indicated a strong association between the SNP and OSAHS while controlling for BMI (χ2 = 5.412; P = .020; common OR,1.643; 95% confidence interval, 1.1–2.455) (Table 4).Table 4. Frequencies of genotypes of the prepro-orexin gene polymorphism between subgroups classified by BMI within subjects Nonobese subjects Obese subjectsOSAHS Control Total OSAHS Control TotalC/T+T/T 83 (51.23) 79 (48.77) 162 49 (87.5) 7 (12.5) 56C/C 47 (38.5) 75 (61.5) 122 38 (70.37) 16 (29.63) 54χ2 4.529 4.878 P 0.033 0.027 OR 1.677 (1.04–2.702) 2.947 (1.102–7.885) Cochran χ21 5.911 P .015 Mantel-Haenszel χ21 5.412 P .020 Common OR 1.643 (1.1–2.455) Data are presented as n (%); obese subjects (BMI, >30 kg/m2) and nonobese subjects (BMI, <30 kg/m2).We also performed direct sequencing analysis of the promoter/exon-1 region in patients with OSAHS and healthy controls. No other polymorphisms were found in any subject.4. DiscussionThe present study is the first report on the association of OSAHS with g1182C>T, a genetic variant in the exon 2 of the prepro-orexin gene. Both genotype (C/T) and allele (T) of the g1182C>T SNP have significant association with OSAHS.

The prepro-orexin gene, on human chromosome 17q21–22, consists of 2 exons and 1 intron. Exon 2 encodes a propeptide from which the orexins A and B are cleaved proteolytically [24]. The pleiotropic effects of orexin are not only on appetite regulation but also on sleep architecture [25]. The prepro-orexin gene is expressed in a variety of brain areas that are important for the regulation of breathing, and the roles of orexin in neural control of the sleep-wake cycle have direct implications in OSAHS. The previous studies on orexin knockout mice have shed light on a direct role of orexin in cardiorespiratory control [18]. Orexin knockout mice show an excessive daytime sleepiness phenotype with instability in their arousal states [26] and exaggerated sleep apneas [27]. Besides an attenuated hypercapnic chemoreflex [28], orexin deficiency in mice impairs long-term facilitation of respiratory motor outputs in response to intermittent hypoxia [29].

In addition, orexin may exert a control of the genioglossus muscle activity that has a major role in OSAHS. Animal studies showed that orexin neurons can excite hypoglossal motoneurons through direct projections. In addition, hypoglossal premotoneurons have been identified in the Kölliker-Fuse [30], and orexin B microinjected in the Kölliker-Fuse nucleus enhances preinspiratory activity of the hypoglossal nerve [31]. Therefore, orexin deficiency can result in decreased excitability of genioglossus motoneurons; and lacking orexin excitatory drive to hypoglossal premotoneurons in the Kölliker-Fuse nucleus could diminish the preinspiratory protrusion of the tongue, which is physiologically required to reduce upper airway resistance before the active inspiratory phase. This can undoubtedly increase the risk of hypoglossal-related upper airway obstruction in orexin knockout mice.

Although the association between prepro-orexin g1128C>T and OSAHS appears solid, its functional implications are currently poorly understood. It is entirely unclear whether this C/T nucleotide exchange substitution affects ligand binding, effector coupling, or desensitization of the orexins A and B. A careful analysis of the prepro-orexin gene and the definition of haplotypes are required to further investigate the functional significance of this polymorphism.

Because all of our subjects were assessed by overnight PSG, an established diagnostic method for OSAHS, we assume these findings are valid. However, some issues need to be addressed. First, although the association with the prepro-orexin gene is based on an SNP in the translated region, how this SNP or its adjacent region relates to OSAHS is difficult to understand at this stage and requires further study. Second, we did not find the other SNP in prepro-orexin gene, including IVS1+16T>C, rs9902709, −909T/C, −22C/T and −20C/A polymorphisms, which were identified in previous studies [32], [33] and [34]. A possible reason for the discrepant results may be the difference of the studied racial populations. Further studies on orexin in larger populations and different races of people, as well as animal studies, if animal models of sleep apnea-hypopnea syndrome are available, would help to clarify the fact on orexin system in patients with OSAHS.

In conclusion, our finding of a genetic variant in the prepro-orexin gene provides a new possible candidate gene for OSAHS. Further work is required to study the extent of the haplotype in prepro-orexin gene involved. Additional replication in larger samples is necessary, including comparison with ongoing genome-wide association studies. The identification of a significant association between the prepro-orexin gene and OSAHS, with possible involvement in excessive daytime sleepiness, ventilator control, and upper airway patency, may have important clinical implications and warrants further study of the orexin in OSAHS.
Acknowledgments

Author contributions: Demin Han, conception, design, acquisition of data, analysis, interpretation, drafting, final approval; Weihu Chen, acquisition of data, analysis, final approval, manuscript preparation; Jingying Ye, design, acquisition of data, analysis, final approval, manuscript preparation; Guoping Yin, acquisition of data, final approval; Boxuan Wang, acquisition of data, final approval; Yuhuan, Zhang, acquisition of data, final approval.

The authors thank the laboratory staff of the Chinese National Human Genome Center, Beijing, China.

This work was supported by the National Natural Science Foundation of China (Grant no. 30730100).

Financial/nonfinancial disclosures: The authors have reported to the American College of Chest Physicians that no significant conflicts of interest exist with any companies/organizations whose products or services may be discussed in this article.
References

[1] T. Young, M. Palta and J. Dempsey, et al. The occurrence of sleep-disordered breathing among middle-aged adults. N Engl J Med, 328 (1993), pp. 1230–1235. | View Record in Scopus | | Cited By in Scopus (4017)

[2] C. Gilleminault and R. Pelayo, Sleep-disordered breathing in children. Ann Med, 30 (1998), pp. 350–356.

[3] J.P. Janssens, S. Pautex and H. Hilleret, et al. Sleep disordered breathing in the elderly. Aging, 12 (2000), pp. 417–429. | View Record in Scopus | | Cited By in Scopus (28)

[4] A. Barcelo, M.A. Elorza and F. Barbe, et al. Angiotensin converting enzyme in patients with sleep apnoea syndrome: plasma activity and gene polymorphisms. Eur Respir J, 17 (2001), pp. 728–732. | View Record in Scopus | | Cited By in Scopus (28)

[5] L.J. Palmer, S.G. Buxbaum and E.K. Larkin, et al. Whole genome scan for obstructive sleep apnea and obesity in African-American families. Am J Respir Crit Care Med, 169 (2004), pp. 1314–1321.

[6] K. Sakai, T. Takada and H. Nakayama, et al. Serotonin-2A and 2C receptor gene polymorphisms in Japanese patients with obstructive sleep apnea. Intern Med, 44 (2005), pp. 928–933.

[7] R.L. Riha, P. Brander and M. Vennelle, et al. Tumour necrosis factor-alpha (-308) gene polymorphism in obstructive sleep apnoeaehypopnoea syndrome. Eur Respir J, 26 (2005), pp. 673–678.

[8] L. De Lecea, T.S. Kilduff and C. Peyron, et al. The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A, 95 (1998), pp. 322–327.

[9] T. Sakurai, A. Amemiya and M. Ishii, et al. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G-coupled receptors that regulate feeding behavior. Cell, 92 (1998), pp. 573–585.

[10] C. Peyron, D.K. Tighe and A.N. van den Pol, et al. Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci, 18 (1998), pp. 9996–10015.

[11] J.P. Nixon and S. Smale, A comparative analysis of the distribution of immunoreactive orexin A and B in the brains of nocturnal and diurnal rodents. Behav Brain Funct, 3 (2007), p. 28.

[12] K. Yoshida, S. McCormack and R.A. Espanña, et al. Afferents to the orexin neurons of the rat brain. J Comp Neurol, 494 (2006), pp. 845–861.

[13] T. Sakurai, R. Nagata and A. Yamanaka, et al. Input of orexin/hypocretin neurons revealed by a genetically encoded tracer in mice. Neuron, 46 (2005), pp. 297–308.

[14] N.C. Tkacs, Y. Pan and G. Sawhney, et al. Hypoglycemia activates arousal-related neurons and increases wake time in adult rats. Physiol Behav, 91 (2007), pp. 240–249.

[15] H. Ganjavi and C.M. Shapiro, Hypocretin/orexin: a molecular link between sleep, energy regulation, and pleasure. J Neuropsychiatry Clin Neurosci, 19 (2007), pp. 413–419.

[16] K. Ohno and T. Sakurai, Orexin neuronal circuitry: role in the regulation of sleep and wakefulness. Front Neuroendocrinol, 29 (2008), pp. 70–87.

[17] C.G. Diniz Behn, N. Kopell and E.N. Brown, et al. Delayed orexin signaling consolidates wakefulness and sleep: physiology and modeling. J Neurophysiol, 99 (2008), pp. 3090–3103.

[18] T. Kuwaki, W. Zhang and A. Nakamura, et al. Emotional and state-dependent modification of cardiorespiratory function: role of orexinergic neurons. Auton Neurosci, 142 (2008), pp. 11–16.

[19] T. Kuwaki, Orexinergic modulation of breathing across vigilance states. Respir Physiol Neurobiol, 164 (2008), pp. 204–212.

[20] S. Nishino, Clinical and neurobiological aspects of narcolepsy. Sleep Med, 8 (2007), pp. 373–399.

[21] T. Nishijima, S. Sakurai and Z. Arihara, et al. Plasma orexin-A–like immunoreactivity in patients with sleep apnea hypopnea syndrome. Peptides, 24 (2003), pp. 407–411.

[22] S. Sakurai, T. Nishijima and S. Takahashi, et al. Clinical significance of daytime plasma orexin-A–like immunoreactivity concentrations in patients with obstructive sleep apnea hypopnea syndrome. Respiration, 71 (2004), pp. 380–384.

[23] X. Busquets, F. Barbe and A. Barcelo, et al. Decreased plasma levels of orexin-A in sleep apnea. Respiration, 71 (2004), pp. 575–579.

[24] T. Sakurai, T. Moriguchi and K. Furuya, et al. Structure and function of human prepro-orexin gene. J Biol Chem, 74 (1999), pp. 17771–17776.

[25] J. Lu, D. Sherman and M. Devor, et al. A putative flip-flop switch for control of REM sleep. Nature, 441 (2006), pp. 589–594.

[26] T. Mochizuki, A. Crocker and S. McCormack, et al. Behavioral state instability in orexin knockout mice. J Neurosci, 24 (2004), pp. 6291–6300.

[27] A. Nakamura, W. Zhang and M. Yanagisawa, et al. Vigilance state-dependent attenuation of chemoreflex and exaggerated sleep apnea in orexin knockout mice. J Appl Physiol, 102 (2007), pp. 241–248.

[28] B.S. Deng, A. Nakamura and W. Zhang, et al. Contribution of orexin in hypercapnic chemoreflex: evidence from genetic and pharmacological disruption and supplementation studies in mice. J Appl Physiol, 103 (2007), pp. 1772–1779.

[29] J. Terada, A. Nakamura and W. Zhang, et al. Ventilatory long-term facilitation in mice can be observed both during sleep and wake periods and depends on orexin. J Appl Physiol, 104 (2008), pp. 499–507. | View Record in Scopus | | Cited By in Scopus (27)

[30] C. Gestreau, M. Dutschmann and S. Obled, et al. Activation of hypoglossal motor and premotor neurons during various oropharyngeal behaviors. Respir Physiol Neurobiol, 147 (2005), pp. 159–176. Article | PDF (643 K) | | View Record in Scopus | | Cited By in Scopus (40)

[31] M. Dutschmann, M. Kron and M. Mörschel, et al. Activation of orexin B receptors in the pontine Kölliker-Fuse nucleus modulates preinspiratory hypoglossal motor activity in rat. Respir Physiol Neurobiol, 159 (2007), pp. 232–235. Article | PDF (352 K) | | View Record in Scopus | | Cited By in Scopus (15)

[32] M. Hungs, L. Lin and M. Okun, et al. Polymorphisms in the vicinity of the hypocretin/orexin gene are not associated with human narcolepsy. Neurology, 57 (2001), pp. 1893–1895. | View Record in Scopus | | Cited By in Scopus (30)

[33] M. Gencik, N. Dahmen and S. Wieczorek, et al. A prepro-orexin gene polymorphism is associated with narcolepsy. Neurology, 56 (2001), pp. 115–117. | View Record in Scopus | | Cited By in Scopus (42)

[34] I. Rissling, Y. Körner and F. Geller, et al. Preprohypocretin polymorphisms in Parkinson disease patients reporting “sleep attacks”. Sleep, 28 (2005), pp. 871–875. | View Record in Scopus | | Cited By in Scopus (15)

☆The source of financial support: This work was supported by the National Natural Science Foundation of China (Grant no. 30730100).

Corresponding Author Contact InformationCorresponding author. Department of Otorhinolaryngology, Head and Neck Surgery, Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, Beijing 100730, China. Tel.: +86 10 58265782; fax: +86 10 65131244.

1Co–first author: Chen Weihu, MD, and Ye Jingying, MD, contributed equally to this work.

American Journal of Otolaryngology
Volume 33, Issue 1, January-February 2012, Pages 31-36

'Tinnitus freaked me out - I heard sinister sounds'

2011-11-24T22:04:00.000-08:00

Andrew Goodwin's definition of his tinnitus is frank.

"It's a noise I can't identify which freaks me out."

He first began to hear a weird, piercing noise in his ears aged 31. On the same day in 2002, Andrew became profoundly deaf.

It was a terrifying and lonely time for him. Eighteen months later he discovered hearing aids which were powerful enough to help him hear again, but the tinnitus remained.

The noise he hears, but which no one else can, takes on a different character depending on how Andrew is feeling.

"When I am stressed it sounds like wind rushing through the trees. But at night after a long day it can be sinister. It sounds like there are voices, whispering..."

"Initially I didn't know what it was or where it was coming from. I thought I was going mad," he says.

Five million people in the UK are thought to live with tinnitus, but not all suffer from hearing loss as well.

The British Tinnitus Association says that about 10% of the UK adult population have mild tinnitus all the time and, in up to 1% of adults, this may affect their quality of life.

Tinnitus is the perception of sound in the absence of any actual, corresponding external sound and it can occur at any age - even in quite young children.

Although the precise cause of tinnitus is still not fully understood, experts say there are certain things which should be avoided.
Continue reading the main story
“Start Quote

Loud music is fun but we must be careful too.”

Dr David Baguley CAmbridge University Hospitals

David Baguley, consultant clinical scientist at Cambridge University Hospitals and vice chairman of the British Tinnitus Association, urges care around loud music.

"Intense sound can cause changes to the hearing system and can then lead to tinnitus. Loud music is fun but we must be careful too."

The ear is an extremely sensitive organ which has to deal with a massive range of sound levels - from a whisper at 30 decibels to a busy bar at 80-90 dB and a noisy club at 100 dB or more.

This sort of noise level is thought to be "safe" for fewer than 30 minutes.

Conrad Jarvis was listening to music two years ago when he suddenly heard a "crackling" noise in his left ear.

He initially put it down to the new headphones he was wearing before he realised there had been a permanent change in his hearing.

At first he did not notice the tinnitus.
Conrad Jarvis Conrad's hearing aid has helped him cope with tinnitus and continue working as a DJ

"It just came on... this high-pitched sound. It was constantly there, sometimes it changed in pitch. It did drive me crazy," he says.

As a DJ who played everything from soul to R&B and house music, often at high volumes, Conrad thought his music career was finished.

But he was persuaded to have an operation and then use a hearing aid, which is now the only thing that quietens the tinnitus.

"After lots of hearing tests I realised my ear drum was damaged - so I just knew that was it for the rest of my life."

He was very reluctant to wear a big, pink hearing aid - particularly as he is of Caribbean descent - but he managed to get a small, brown digital hearing aid which most of his friends mistake for a blue tooth device.

"I've got back my sense of balance on my left-hand side and the hearing aid has reduced the tinnitus dramatically," Conrad says.
Continue reading the main story
“Start Quote

After a long, tiring day, tinnitus is my way of telling me to slow down.”

Andrew Goodwin

There are various treatments available which can help people deal with tinnitus. These include hearing aids, relaxation techniques to try to reduce anxiety levels and a bedside sound generator which produces the sound of rain, the ocean or birds to help induce sleep.

"For those seriously affected by tinnitus, psychological therapy in the form of cognitive behavioural therapy can be tried," Dr Baguley says.

Andrew Goodwin took up the relaxation technique Tai Chi to help him deal with his tinnitus, which he found very successful.

"The breathing exercises helped me relax and that calmed down the tinnitus," he says.

Stress and anxiety can also affect tinnitus levels, as Andrew testifies.

"If I get stressed, my tinnitus gets worse. After a long, tiring day, tinnitus is my way of telling me to slow down."

Current research on tinnitus is focusing on drugs which could have affect the intensity of the tinnitus, and on the use of filtered music to reduce the sound of the tinnitus.

Research is also being carried out into how the activity of the brain can be influenced using magnetism or electrical stimulation. This research is at a more experimental stage, says Dr Baguley.

Andrew's experience led him to become information and outreach advisor for Deafness Research UK. His job is to tour the country talking to people about how to look after their hearing and advising them on how to cope with hearing loss and tinnitus.

His advice on tinnitus is simple: "Talk to someone about it. There is help. You can't cure it but you can make it manageable."
Fuente: http://www.bbc.co.uk/news/health-12698862

Allergic to sound: The debilitating condition, suffered by thousands of Britons, that makes everyday noise excruciatingly loud

2011-11-24T21:44:00.000-08:00

By Isla Whitcroft

8th March 2011

Standing in the shower, musician Chris Singleton flinched as he turned the tap on to full. ‘I knew what was coming,’ he says. ‘If I was lucky, I could bear ten seconds under the water before the urge to switch it off became overwhelming.

‘Flushing the loo was even more scary. I became adept at pushing down the handle and then running for the door.’

Chris, 33, was not struggling with an aversion to bathrooms or a water phobia. Rather, he was suffering from hyperacusis — acute sensitivity to sound.
Shhhhh: For those who suffer from hyperacusis, just the sound of a loo flushing can be excruciating

Shhhhh: For those who suffer from hyperacusis, just the sound of a loo flushing can be excruciating

‘It was like a bad joke,’ says Chris ruefully. ‘A rock musician who is allergic to loud noises. But it was actually a nightmare. The sound of certain noises — such as the toilet flushing or the telephone ringing — was actually physically painful.

‘The pain was sharp, the sort of discomfort people with normal hearing would feel if they heard the high-pitched squeal of microphone feedback.’

Hyperacusis is a hypersensitivity to certain sounds at a volume that others find normal, explains Dr Veronica Kennedy, a specialist at NHS Bolton.

Me and my operation: Sucking the jelly out of my eyeballs made my annoying floaters vanish
Balloon in your tum that helps you lose weight

‘Which sounds become painful varies from person to person,’ she says. ‘For some people, the problem may be occasional and fairly mild, but for others it can become extremely life-limiting — to the point where they stop going out and gear their entire life around being in as quiet an environment as possible.’

Experts estimate that between two and five per cent of the adult population will suffer from hyperacusis at some point, but are unclear why it occurs.

‘There are theories that it can be triggered by exposure to a sudden loud noise or it may be linked to a stressful event or a trauma, such as an accident,’ says Dr Kennedy. But in all cases the effect is the same: the internal hearing level is reset.

Chris first noticed something was wrong in early 2004, when his left ear started to feel full, as if he had been swimming and it had fluid in it. ‘After a couple of weeks, I went to see my GP, who said that there was a hole in my eardrum and gave me antibiotics,’ he says.
Like a bad joke: For rock musician Chris Singleton, being allergic to loud noises has been a nightmare

Like a bad joke: For rock musician Chris Singleton, being allergic to loud noises has been a nightmare

‘It healed within a couple of weeks, but by then I was starting to find certain noises — particularly high-pitched ones — painful. And not just in my left ear; my right ear was behaving strangely, too.’

Chris adds: ‘This started to have a subtle effect on my behaviour. When getting on a train, I would always look for the loudspeakers which announced the station names, and find a seat as far away as possible; in cafes, I had to avoid going near the espresso machine.

‘At that stage, the sound of people talking at a normal level was OK, although this changed later on. But bars and clubs became a no-go area without earplugs.

‘The problem was that when I took the plugs out, everything seemed much louder.’

In fact, while many people with hyperacusis wear earplugs, it’s the worst thing they can do. Dr Kennedy explains: ‘When you hear a sound, your brain interprets what level it is at, then translates that so you can hear it properly.

‘If the sound is muffled because you’re wearing earplugs, the brain simply turns up the internal volume so the sound is audible.

‘Then, when you take the earplugs out, everyday sounds are even louder, so you wear the earplugs more often and your brain turns up the internal volume again. It’s a vicious circle.’

A more fundamental problem is lack of awareness of hyperacusis among the general public and even within the medical profession, says Dr Kennedy.

‘Often, people are initially misdiagnosed as having ear infections, sinus problems and, most commonly, tinnitus. This, of course, can lead to distress for the patients who have to live day-to-day with what can be a very miserable condition.’
Hyperacusis is most likely triggered by physical causes like a head injury or overexposure to loud noise. But anxiety plays a big part, too

Hyperacusis is most likely triggered by physical causes like a head injury or overexposure to loud noise. But anxiety plays a big part, too

As Chris was to discover. During the first few months, he went back to his GP several times and saw two private ear, nose and throat consultants who all said there was nothing wrong.

After four months, he was ‘desperate’. ‘Most musicians love the sound of their own voice, but I couldn’t bear mine. I was recording my first album and had to turn the volume down very low and wear earplugs.’

His personal life was also suffering. ‘I became extremely irritable and a nightmare to live with. My relationship with my girlfriend suffered considerably — she had to tiptoe whenever I was around. It led to rows where both of us had to whisper at each other as shouting was out of the question.’

Chris turned to the internet, and discovered his problem was hyperacusis. ‘Although it was a relief to work out what was wrong, there were some pretty upsetting stories about people who had been driven almost to suicide,’ he says.

‘I never got that bad, although at one point I did consider going on anti-depressants.’

However, when he saw another private consultant, who prescribed an anti-anxiety drug with strong side-effects, Chris decided against taking it.

By then, he was living in London, and was referred to an NHS consultant at Barts and The London NHS Trust. ‘He couldn’t have been more different from the others — he actually listened to me,’ says Chris.

After four months, I was desperate. Most musicians love the sound of their own voice, but I couldn’t bear mine

‘He gave me tests to determine just how bad my hyperacusis was. He explained that much of what I was experiencing was anxiety related. Hyperacusis is most likely triggered by physical causes — for example, a head injury or overexposure to loud noise. But anxiety plays a big part, too.

‘Because of this he said my hearing would benefit from psychological therapy. I thought the idea quite funny but, unbelievably, it worked.’

Explains Chris: ‘Once the therapist was able to reassure me there was absolutely nothing wrong with my hearing and that loud noises — as long as they weren’t ridiculously loud — were perfectly within the range of the coping mechanism of the human ear, I stopped being frightened of them.’

He gave up his earplugs, which was hard for a few weeks because noises were very loud. But about six weeks after first seeing the consultant, he was able to sit in a bar without a problem. ‘It was a wonderful moment. I felt normal again,’ says Chris.

Dr Kennedy explains: ‘If you can get the patient to understand the link between the hyperacusis and the anxiety, and give them a few pointers to deal with those issues, the problems can be solved sometimes surprisingly quickly.’ Hyperacusis can also be treated with de-sensitisation, where noise is played at gradually increasing volumes to readjust the patient’s hearing to everyday volumes.

While he considers himself cured, Chris — who has just released his second album, Lady Gasoline — admits there are still times, usually when he is tired or stressed, that loud noises can start to irritate him.

‘When this happens, I take a grip of myself, if you like,’ he says. ‘But I am annoyed that to get to this stage I had to see three GPs, three consultants, three nurses, two trainee hearing therapists and a hearing therapist.

‘The emotional cost had been huge, too. I nearly gave up on my music and my girlfriend.

‘Eventually, I got very good help from the medical profession, but if there was more knowledge about hyperacusis I am sure I could have got better much quicker — and avoided all those whispered fights with my girlfriend!’

Lady Gasoline is out on IRL/Proper and can be bought on iTunes; www.chrissingletonmusic.com

Fuente: http://www.dailymail.co.uk/health/article-1363993/Allergic-sound-The-debilitating-condition-suffered-thousands-Britons-makes-everyday-noise-excruciatingly-loud.html#ixzz1eh2nwk7w

Punk rock: Anarchy in the UK tribute tour in Caerphilly

2011-11-24T21:29:00.000-08:00

A 35th anniversary recreation of a controversial punk concert leaves BBC Wales' Nick Horton feeling nostalgic, not too embarrassed, and with gratifying ringing in the ears.

One of the posters at the back of the Caerphilly Workingmen's Hall read: "Punk's not dead".

Well, maybe not. But like many of the 150 or so who dragged our aching bones out for this gentle jog - it's the liveliest exertion most of us can manage - down a rowdy memory lane, it's certainly showing its age.

Here's why we were there: in winter 1976, Caerphilly was the south Wales destination for the Anarchy in the UK tour, headlined by the Sex Pistols, and including The Clash, and Johnny Thunders and the Heartbreakers.

But this was no ordinary rock show. The Pistols, having recently sworn on tea-time telly, were at the height of their notoriety, many of the tour dates were cancelled, and protesters gathered to sing carols and pray for the misguided souls inside the town's Castle Cinema.

Only a few dozen were in the venue. But, like many of these infamous gigs, hundreds subsequently claimed to have pogoed the Caerphilly night away.

Mostly male

For 14-year-olds like me the 1976 gig had come a few months too soon, when this noisy musical fad was just a weird London obsession splashed over the tabloids, and Eddie and the Hot Rods were the nearest thing to punk I'd ever heard. And anyway, it was in the neighbouring valley, and therefore a million miles away.

Forward 35 years, and the 2011 version was the nearest we oldies were going to get to reliving something we never saw. Of course, they weren't the original bands, by virtue of many of their members unfortunately being dead.

But still. Here at least was one original: Billy Rath, the Heartbreakers' bassist, looking every inch the man who has enjoyed a full rock 'n' roll lifestyle, in his own tribute band, the Broken Hearts. After a classically chaotic start in the punk spirit, when Rath couldn't get his bass to emit a sound, they faithfully recreated the meat and potatoes cheap thrills the Heartbreakers imported from New York.

One rule of music writing always used to be: don't review the audience. But it's unavoidable in this case, because the crowd were integral to the show. Punk always was a mostly male preserve, and so it proved again in Caerphilly.

Leather-jacketed MC

Just like ye olden days, a bunch of boisterous blokes jumped around in front of the stage. While they included a few mohican-wearing twenty-somethings, they looked mostly middle-aged, portly and shiny-headed - yup, that'll be me, then - and you had to be brave to risk venturing into this anarchic moshpit. And, nope, that wasn't me.

One disappointment was the non-appearance of Ray Davies - no, not that one, Kinks fans - but the radical local councillor who had been among the 1976 protesters. But he later changed his mind, deciding he had no right to tell young people how to have fun, and had been due on stage to introduce the 2011 night.

But the leather-jacketed MC told us that Mr Davies couldn't make it. And again with real punk ethos, he started to explain the context of the show, before admitting he couldn't be bothered and made way for the bands.

Then came the undoubted highlight: Rebel Truce, the Clash tribute band. Until a few years ago I wouldn't have dreamed of going to see them out of embarrassment at trying to relive a long-gone past.

Pedantic punk historians

But thankfully I've cleared the shame hurdle, and Rebel Truce are everything you want from a tribute band. They play almost all the greatest songs - although with The Clash you'd need hours just to scratch the surface of their classic material - and manage to look and sound like them without descending into pastiche.

Which is more than you can say for the Sex Pistols Experience, the headline act. They were a faithful facsimile of the Pistols, with an uncannily accurate Johnny Rotten in his pre-butter salesman and I'm a Celebrity, Get Me Out of Here days, sneering: "Welcome to Cardiff's car park".

The Sid Vicious-alike was equally impressive, even mock-threatening to bash a fan with his bass at one point, although pedantic punk historians among us will point out that he never appeared at Caerphilly, when his Beatles-loving predecessor Glen Matlock was still in the band.

As powerful as they were, the Sex Pistols Experience came over as more of a cabaret act, emphasising why they were ultimately usurped by The Clash as the punk band who really mattered.

But reviewing the music on a night like this is, frankly, a little pointless. It was all about being there, and going home with a gratifying ringing in the ears from standing close to the speakers. Not too close these days, mind.

As someone who had notched up pretentious middle-class brownie points earlier in the day by searching for balsamic glaze and sour dough bread in Waitrose, it was a little unsettling to be thrown back to my O-level era.

Particularly as these days a wild time in my book amounts to searching B&Q for an allen key in the UK. OK, not my joke, but one I can't resist stealing.

Thankfully, the club had comfy seats to rest my weary limbs, and it was over not long after midnight. So punk's not dead. But punk is mostly for dads these days, just as it should be.

Fuente: http://www.bbc.co.uk/news/mobile/uk-wales-south-east-wales-15414685

Ruidos de nuestro planeta o del espacio exterior

2011-11-23T20:16:00.000-08:00

El misterioso "zumbido" que se percibe en diversos países del mundo constituye un reto para estudiosos y resulta hoy un enigma aún no descifrado.

Denominado " Hum" en inglés, es básicamente el nombre genérico de un evento sonoro persistente e invasivo de baja frecuencia que no es escuchado por todas las personas ni puede ser evitado con audífonos, según afirma Robert Stask, de la revista Misterios sin resolver.

Todo comenzó en el poblado de Taos, en el estado de Nuevo México, y por eso muchos expertos lo llaman el "Zumbido de Taos", para poder registrarlo como un fenómeno que ya se experimenta en todos los continentes.

En Hawai, por ejemplo, el sonido es escuchado fundamentalmente por personas que lo describen como un motor de diesel acelerado; normalmente no se puede registrar con micrófonos, y su fuente y naturaleza son prácticamente imposibles de localizar.

Algunas personas escuchan el ruido dentro de sus hogares, pero no al aire libre y lo perciben como vibraciones en el cuerpo y no tanto en el tímpano, especialmente en horas de la noche; en tanto otras lo sienten continuamente y ciertos hombres y mujeres solamente en determinados momentos.

Varias reacciones a este evento pueden interferir seriamente con las actividades diarias y la salud humana, como son el insomnio, la ansiedad y otras alteraciones nerviosas, manifiesta el doctor Tom Moir, de la Universidad de Massey, en Nueva Zelanda.

HISTORIAL DEL EXTRAÑO SUCESO

Los primeros indicios del sonido aparecieron en la década de 1970 en Estados Unidos pero los expertos sólo los comenzaron a investigarlo con seriedad veinte años después, tras numerosas quejas de ciudadanos y autoridades locales.

Alrededor de esa misma fecha, otros individuos presentaron quejas similares en Nueva Zelanda y Reino Unido, pero nadie puede asegurar aún que se trata de un evento sonoro similar en los dos países.

En el caso del poblado de Kokomo, en el estado de Indiana, Estados Unidos, la existencia de grandes industrias pesadas hacen que los científicos consideren el ruido generado por dos grandes ventiladores de enfriamiento, ubicados en la fábrica de automóviles Chrysler, que emiten un elevado nivel sonoro.

El diario Albuquerque Journal publicó numerosos reportajes sobre este enigma donde se informa que muchos afectados lo relacionan con objetos voladores no identificados, con cuestiones de fantasmas, con trabajos de minería subterráneos secretos, con líneas de alto voltaje y con pruebas clandestinas de armamento nuclear a grandes profundidades.

Uno de los posibles orígenes del zumbido, apuntan otros investigadores, pudieran ser los procedimientos de comunicación de submarinos militares, tales como el ELF (Sistema de Frecuencias Extremadamente Bajas), que son capaces de atravesar la tierra y el mar en cualquier dirección.

Mientras, otra opción la representan los sistemas de calentamiento ionosféricas de muy alta frecuencia, llevados a cabo por Estados Unidos, Rusia y Noruega, tales como el denominado HAARP, desarrollado en Alaska desde 1993.

Hacia otro plano de las hipótesis, el "zumbido" podría ser provocado por factores naturales, como el movimiento de las placas terrestres, las ondas electromagnéticas causadas por meteoritos y las ondas producidas por la interacción del campo magnético terrestre con el viento solar.

Entre las múltiples causas investigadas, figura la que el Hum se limitaría a ondas producidas por la ionización del aire en torno a fuentes eléctricas de alta tensión cercanas a los poblados afectados.

James Nelly, profesor de la Universidad de Nuevo México, afirma que todas las personas afectadas por el sonido cuentan historias muy creíbles, las cuales demuestran que no son debido a perturbaciones mentales ni se asientan en falacias.

Este eco constituye un desafío para los científicos, que aún no encuentran una explicación racional a fin de describir el misterioso origen de estos zumbidos.

Por Silvio González*
*Jefe del Departamento de Difusión de Prensa Latina.

arb/sgl
Fuente: Prensa Latina

Comentario

2011-11-19T11:38:00.000-08:00

Javier Mujica / Concepción / CHILE ha dejado un nuevo comentario en su entrada "tinnitus, tratamiento con fármacos":

Realmente para las personas que soportamos esta desagradable molestia del TINNITUS encontrar un método o tratamiento para el mísmo es tener la esperanza en poder algún día mejorar nuestra deteriorada calidad de vida...Gracias

Vista de Laguna Chica San Pedro, Concepcion - CHILE

N de la R. Javier, Gracias por sus comentarios

Effects of altered auditory feedback across effector systems: Production of melodies by keyboard and singing

2011-11-19T11:31:00.000-08:00

Authors:
Peter Q. Pfordresher ; James T. Mantella
a University at Buffalo, State University of New York, United States

Available online 17 November 2011.

Abstract
We report an experiment that tested whether effects of altered auditory feedback (AAF) during piano performance differ from its effects during singing.

These effector systems differ with respect to the mapping between motor gestures and pitch content of auditory feedback.

Whereas this action-effect mapping is highly reliable during phonation in any vocal motor task (singing or speaking), mapping between finger movements and pitch occurs only in limited situations, such as piano playing.

Effects of AAF in both tasks replicated results previously found for keyboard performance (Pfordresher, 2003), in that asynchronous (delayed) feedback slowed timing whereas alterations to feedback pitch increased error rates, and the effect of asynchronous feedback was similar in magnitude across tasks.

However, manipulations of feedback pitch had larger effects on singing than on keyboard production, suggesting effector-specific differences in sensitivity to action-effect mapping with respect to feedback content.

These results support the view that disruption from AAF is based on abstract, effector independent, response–effect associations but that the strength of associations differs across effector systems.

Highlights

► Tested effects of altered auditory feedback (AAF) in piano performances and singing.
► Effects of AAF similar across domains for disruption of timing versus sequencing. ► However, singing was more vulnerable to disruption from alterations of pitch. ► Suggests effector-independent sensorimotor associations that vary in magnitude.

Fuente: Acta Psychologica
doi:10.1016/j.actpsy.2011.10.009

El lado oscuro de la neuroplasticidad

2011-11-19T11:22:00.000-08:00

Autores: Arthur Autor Brown , Lynne C. Weavera

El lado oscuro de la neuroplasticidad, una lesión de laboratorio de la médula espinal,
Robarts Research Institute, Universidad de Western Ontario, London, Ontario N6A 5K8

Disponible en Internet el 12 de noviembre de 2011.

Neuroplasticidad
fuente de la imagen:2009 Surya. Contacto: e-mail: secretariadeldojo@yahoo.es Telf: + 34 639 187 140

Sea dramática o moderada, la recuperación de la función neurológica después de una lesión de la médula espinal (SCI) es en gran medida debida a la neuroplasticidad - el proceso por el cual el sistema nervioso responde a la lesión mediante el establecimiento de nuevas conexiones sinápticas o mediante la alteración de la fuerza de las sinapsis existentes.

Sin embargo, la neuroplasticidad mismo que permite recuperar la función locomotora también produce consecuencias negativas como dolor y disfunción de los órganos controlados por el sistema nervioso autónomo.

Esta revisión se centrará específicamente en la neuroplasticidad estructural (el crecimiento de nuevas conexiones sinápticas) después de la lesión y en el consiguiente desarrollo de dolor y disreflexia autonómica, una condición de hipertensión episódica.

La Neuroplasticidad después de la lesión es estimulada por la desaferentización de las neuronas espinales por debajo de la lesión y por la expresión de factores de crecimiento o neurotrofinas como el factor de crecimiento nervioso (NGF).

Una amplia gama de estrategias terapéuticas que afectan a la neuroplasticidad se están desarrollando para el tratamiento del SCI.

En un extremo del espectro están las estrategias terapéuticas que aumenten directa o indirectamente el NGF en la médula espinal lesionada, y los efectos más sólidos sobre la neuroplasticidad.

En el otro extremo del espectro están las estrategias neuroprotectoras centradas en el apoyo y el rescate de los axones lesionados o heridos parcialmente,los cuales podrían limitar el estímulo de neuroplasticidad de la desaferentación .

En medio de este espectro se encuentran las estrategias que bloquean los inhibidores de crecimiento axonal sin necesidad de un estímulo de crecimiento.

La literatura apoya la idea que las consecuencias negativas de la neuroplasticidad a desarrollar con mayor frecuencia con terapias que estimulan directamente el crecimiento del nervio se desarrollan en la médula espinal lesionada sin tratar.

En comparación con estas condiciones, la neuroplasticidad con resultados negativos es menos frecuente después de realizar tratamientos mediante inhibidores que neutralizan el crecimiento axonal, y por lo menos aparentemnte después de las estrategias que promueven la neuroprotección.

Fuente:Experimental Neurology
doi:10.1016/j.expneurol.2011.11.004

Filosofia en el foro de acúfenos de España

2011-11-19T11:00:00.000-08:00

las diez mejores frases de filosofia:

"Pocos ven lo que somos, pero todos ven lo que aparentamos." Maquiavelo.

"Cuando una batalla está perdida, queda la retirada; sólo los que han huido pueden combatir en otra." Demóstenes.

"La filosofía es la ciencia que complica las cosas que todo el mundo sabe". Juan Benet.

"Felicidad no es hacer lo que uno quiere sino querer lo que uno hace." Jean Paul Sartre.

"No sabemos lo que nos pasa y eso es precisamente lo que nos pasa." Ortega y Gasset.

"El que domina a los otros es fuerte; el que se domina a sí mismo es poderoso." Lao-tsé.

"Sorprenderse, extrañarse, es comenzar a entender." Ortega y Gasset.

"Si abordas cada situación como asunto de vida o muerte, morirás muchas veces." Adam Smith.

"En general, las nueve décimas partes de nuestra felicidad se fundamentan en la salud." Arthur Schopenhauer"

El sabio puede cambiar de opinión. El necio, nunca." Immanuel Kant.

Fuente: http://www.acufenos.org/~foro/

Un fan de Them Crooked Vultures se suicida por sufrir tinnitus durante meses tras un concierto del grupo

2011-11-19T10:48:00.000-08:00

Autor: James Ulrich 19/11/2011

Terrible noticia que nos llega desde el Reino Unido.
Robert McIndoe, un inglés de 52 años, se apuñaló hasta llegar a la muerte tras sufrir durante tres meses tinnitus, enfermedad que hace sentir un pitido continuo en los oídos proveniente del interior, y por lo cual no pudo dormir durante todo ese tiempo.

Este caso grave de tinnitus habría sido provocado tras asistir a un concierto del super-grupo Them Crooked Vultures, formado por Dave Grohl (frontman de Foo Fighters) a la batería, Josh Homme (líder de Queens of the Stone Age) a la voz y a la guitarra, y John Paul Jones (veterano de Led Zeppelin) al bajo.

Tras intentarlo todo para remediarlo y diagnósticos fallidos de los médicos, el hombre no pudo aguantar más y decidió poner fin a su vida, a pesar de tener mujer y dos hijos.

Them Crooked Vultures

Parece ser que en su día no le dio mucha importancia, ya que “puede ser algo normal” y le había ocurrido también a un amigo suyo en el mismo concierto, pero días después no tardó en maldecir el no haber usado tapones de los oídos, convirtiendo su vida en un completo infierno.

Ya nos podemos imaginar cómo pudo ser si llegó al punto de decidir querer morir…

Esto abre de nuevo el debate de si debería limitarse de alguna manera el volumen máximo de sonido que puede haber en un concierto o de la obligatoriedad de usar tapones de los oídos para amortiguar el posible efecto perjudicial.

Y esto no se aplica sólo al público de los conciertos, sino a los reproductores de música con cascos que todos tenemos y a los propios artistas.

Son numerosos los casos de músicos que sufren o sufrieron de esta enfermedad. Véanse como ejemplos James Hetfield, Lars Ulrich (ambos de Metallica), Neil Young, Pete Townshend (The Who), Barbra Streisand, Moby, Will.i.am., Ville Valo (HIM), Myles Kennedy, Joey Jordison (Slipknot), Eric Clapton, Bono (U2), Beethoven, o ya fuera del ámbito musical, personalidades como Goya, Charles Darwin o hasta el propio Adolf Hitler.

Vía: Blabbermouth y DailyMail
Fuente: Them Crooked Vultures: Página oficial

Nota de la Redacción: Referente al caso que describe la nota reproducida mas arriba, tenemos la impresion que la posibilidad de suicidio entre los pacientes con acúfenos es altamente infrecuente, y pensamos ocurre en personas con algun trastorno grave y previo de la personalidad, no hemos visto ningún caso de suicido entre alrededor de 4500 pacientes asistidos personalmente desde 1985 tanto en nuestra practica pública en el Hospital de Clinicas General San Martín de Buenos Aires, ni en nuestra actividad privada en el Centro de Acúfenos de Buenos Aires.
Dr. Dario Roitman.