Original contribution
Weihu Chen MD1, a, Jingying Ye MD1, a, Demin Han MD, PhDCorresponding Author Contact Information, a, E-mail The Corresponding Author, Guoping Yin MDa, Boxuan Wang MSa, Yuhuan Zhanga
a Department of Otorhinolaryngology, Head and Neck Surgery, Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, Beijing, China
Received 23 October 2010; Available online 2 March 2011.
Abstract
Background
Because of the potential role of orexin neuronal circuitry in the regulation of sleep and wakefulness and arousal and breathing, it seems reasonable to speculate that abnormalities in the prepro-orexin gene could be relevant to studies of obstructive sleep apnea/hypopnea syndrome (OSAHS); and it might be a candidate gene in the pathogenesis of OSAHS.
Objective
The present study investigated whether single nucleotide polymorphisms (SNPs) in the human prepro-orexin gene are associated with OSAHS in Han Chinese people.
Methods
A total of 394 subjects (217 cases and 177 control subjects) were recruited from China. Diagnostic polysomnography was performed in all patients and control subjects. SNPs in potentially functional regions of the gene were identified; and genotypes, determined by direct sequencing.
Results
By sequencing the promoter, 2 exons, and the exon-intron junctions of the prepro-orexin gene, the g11182C>T SNP was identified. Statistical analysis showed that there were significant differences in the genotype distribution between patients with OSAHS and the control group (χ22 = 6.437, P = .04). Variant allele T of the g1182C>T polymorphism was more commonly found in patients with OSAHS as compared with control subjects (χ21 = 5.648, P = .017; odds ratio, 1.449; 95% confidence interval, 1.0466–1.968).
Conclusions
Our results suggest that the prepro-orexin gene polymorphism g1182C>T is associated with susceptibility to OSAHS in Han Chinese. This study provides insights into the genetic information for future studies regarding this gene in OSAHS.
Article Outline
1. Introduction
2. Methods
2.1. Patients
2.2. Polysomnography
2.3. Prepro-orexin gene screening
2.4. Statistical analysis
3. Results
3.1. Characteristics and PSG data of subjects
3.2. Frequencies of genotypes and alleles of the polymorphism in patients with OSAHS and control subjects
3.3. Frequencies of genotypes between subgroups classified by BMI
4. Discussion
Acknowledgments
References
1. Introduction
Obstructive sleep apnea/hypopnea syndrome (OSAHS) is a highly prevalent disorder with multiple comorbidities. Overt sleep apnea has been estimated to affect 2% of middle-aged women and 4% of middle-aged men, at least 1% of preschool children, and at least 11% of the elderly [1], [2] and [3]. Its etiology is complex and multifactorial, with evidence that susceptibility is influenced by risk factors that include obesity and obesity-associated traits, craniofacial characteristics associated with reduced upper airway dimensions, as well as ventilatory deficits that predispose to pharyngeal collapsibility during sleep, when neuromuscular output is either reduced or relatively unstable. Although studies of the genetic etiology of the disorder are few, there are growing data that have quantified the heritability of OSAHS, described potential modes of transmission, and have identified suggestive and/or biologically plausible candidate genes [4], [5], [6] and [7].
The excitatory neuropeptide orexin (or hypocretin) is synthesized by neurons restricted to the lateral hypothalamus. Only 2 splice orexin variants (orexin A and orexin B) derived from a unique precursor have been identified, which bind 2 G-protein–coupled receptors (orexin 1 receptor and orexin 2 receptor) [8] and [9]. Orexin neuron projections target a large number of forebrain, limbic, and brainstem nuclei [10] and [11]; and, in turn, they receive inputs from numerous brain nuclei that govern interoceptive and homeostatic signals [12] and [13]. Orexin signaling is involved in the regulation of many neuronal circuits; the most prominent ones control feeding and energy homeostasis [14] and [15] as well as sleep-wake states [16] and [17]. Orexin signaling has also been implicated as regulator of autonomous processes such as emotion and cardiorespiratory functions [18] and [19]. In rodents, canines, and humans, orexin deficiency is associated with narcolepsy characterized by sleep attacks and sleep fragmentation [20].
Preliminary data suggest that orexin levels are abnormal in patients with OSAHS. In one study, morning orexin levels were significantly lower in patients with sleep apnea than in controls [21]. In a repeat study examining orexin levels later in the day, this difference persisted [22]. Another study found low orexin levels in patients with obstructive sleep apnea but also found that reduced orexin levels with obstructive sleep apnea did not correlate with body mass index (BMI), treatment with continuous positive airway pressure, or with daytime hypersomnolence [23]. These relationships suggest that orexin levels may not necessarily be a consequence of the syndrome but instead may be involved in the pathogenesis of obstructive sleep apnea.
It seems reasonable to speculate that abnormalities in the prepro-orexin gene could be relevant to studies of OSAHS because of the potential impact of these neuropeptides on arousal and muscle tone, both of which influence the behavior of respiratory systems, and/or because of the close proximity of these neurons to central respiratory control centers, with potential interactions between arousal and respiratory centers. Therefore, the present study investigated whether the single nucleotide polymorphisms (SNPs) in the human prepro-orexin gene are associated with OSAHS in Han Chinese people.
2. Methods
2.1. Patients
The study sample consisted of 217 patients with OSAHS (157 males and 60 females) diagnosed by using the overnight polysomnography (PSG). The patients who met the diagnostic criteria of OSAHS were recruited from the sleep laboratory of the Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, China. No patients were suspected of having narcolepsy, which is an incurable disorder characterized by excessive sleepiness that typically is associated with episodes of cataplexy. In patients with OSAHS, the mean ± SD age was 50.53 ± 8.57 years; apnea/hypopnea index (AHI), 53.9 ± 16.4 events/h; and BMI, 28.32 ± 4.62 kg/m2, respectively.
A total of 177 healthy control subjects (113 males and 64 females) were screened for a personal or family history to exclude sleep disorders. The mean ± SD age was 48.91 ± 9.45 years; and BMI, 25.17 ± 3.63 kg/m2 in the healthy control group. In these subjects, AHI had to be below 5/h as confirmed by PSG.
All subjects were unrelated Chinese Han individuals. Patients with OSAHS and healthy control subjects were screened to exclude definite psychiatric disorders (axis I disorders of the Diagnostic and Statistical Manual of Mental Disorders) and taking psychotropic medication regularly. General exclusion criteria were drugs influencing the central nervous system; sleep and heart condition; and diseases such as diabetes, acute or ischemic inflammatory liver diseases, thyroid diseases, and acute or chronic renal diseases.
The study was performed in accordance with the Declaration of Helsinki and was approved by the local ethics committee. Written informed consent was given by all participants.
2.2. Polysomnography
All patients with OSAHS and control subjects underwent overnight PSG. PSG consisted of a continuous polygraphic recording electroencephalography (C3/A2, C4/A1), electrooculogram, submental electromyography, right and left anterior tibialis surface electromyography, electrocardiogram, nasal and oral airflow, thoracic and abdominal movements, and oxyhemoglobin saturation. A tracheal microphone was used to detect snoring, and sensors were used to detect the position during sleep. PSG records were interpreted manually according to standard criteria. Apnea episodes were defined as complete cessation of airflow lasting at least 10 seconds. Hypopnea was defined as at least a 50% reduction in airflow for at least 10 seconds accompanied by a reduction in So2 of at least 4%. AHI was defined as the number of events of apnea or hypopnea per hour during sleep time, based on the results of the overnight PSG.
2.3. Prepro-orexin gene screening
The molecular analysis of the prepro-orexin gene was performed using genomic DNA obtained from the peripheral blood by conventional methods. Mutations in the promoter, 2 exons, and exon-intron junctions of prepro-orexin gene were screened by direct sequencing (GenBank accession no. AF118885). The detailed list of primers can be found in Table 1.
Table 1. Primer pairs used in PCRs conducted on prepro-orexin gene
Coding region Forward primer Reverse primer
5′UTR 5′TAGTGGAAAGGGCAGAAG 3′ 5′ATTGTGACCCACTCCCAGG 3′
Exon 1 5′ATCTTAGACTTGCCTTTGTCT 3′ 5′CAAACACAGGCTCTTAGC 3′
Exon 2 5′GGCGCAAAGCAAGGAGAACT3′ 5′GAGTTCCCAGTGCAAGGCCC3′
Nucleotide bases: A, adenine; C, cytosine; G, guanine; T, thymine.
Polymerase chain reaction (PCR) was carried out in a reaction buffer in a total volume of 25 μL, containing 50 ng of genomic DNA, 1 μL deoxyribonucleotide triphosphate, 1 μL proTaq DNA polymerase (Promega Corp, WI), and 0.5μL of each primer. The PCR was performed for 35 cycles of 94°C for 30 seconds, 60°C for 60 seconds, and 72°C for 45 seconds, with initial denaturation at 94°C for 5 minutes and a final extension at 72°C for 3 minutes (GeneAmp PCR System 9700; PE Applied Biosystems, CA). The PCR products were purified; then, sequencing was performed on an Applied Biosystems model 3730 automated sequencer (Applied Biosystems Corp, CA). Sequence data were compared with the published sequence of GenBank accession no. AF118885.
2.4. Statistical analysis
Descriptive characteristics of group variables are expressed as mean ± SD. The significance of variables between groups was tested by unpaired Student t test. Comparison of genotype and allele frequencies between the groups was subsequently carried out using Pearson χ2 test. In addition, the Cochran-Mantel-Haenszel χ2 statistic was used to test for the association of genotype with OSAHS after adjusting for the BMI. All tests were 2-tailed, and significance level was set at P < .05. The statistical analyses were performed using the program Statistical Package for the Social Sciences 16 (SPSS, Inc, Chicago, IL).
3. Results
3.1. Characteristics and PSG data of subjects
The characteristics of 217 patients with OSAHS and 177 control subjects in overnight PSG are presented in Table 2. There were no significant differences in age and sex ratio between the 2 groups. Body mass index, AHI, nocturnal mean Sao2, and minimum Sao2 in control subjects were significantly different from the patients with OSAHS.
Table 2. Characteristics and PSG data of patients with OSAHS and control subjects
Characteristics OSAHS group (n = 217) Control group (n = 177) t P
Age (y) 50.53 ± 8.57 48.91 ± 9.45 1.784 .075
Sex⁎
Male 157 113 χ2 = 3.272 .07
Female 60 64
BMI (kg/m2) 28.32 ± 4.62 25.17 ± 3.63 −7.386 <.001
AHI (events/h) 45.46 ± 30.12 1.89 ± 1.45 −19.211 <.001
Mean So2 (%) 89.42 ± 4.32 95.33 ± 2.05 9.038 <.001
Lowest Spo2 (%) 73.97 ± 14.52 91.09 ± 2.77 15.455 <.001
Date are presented as mean ± SD.
⁎ χ2 Analysis (2 × 2 contingency table).
3.2. Frequencies of genotypes and alleles of the polymorphism in patients with OSAHS and control subjects
An SNP g1182C>T was identified in the prepro-orexin exon 2. This was a cytosine (C)-thymine (T) SNP 349 base pairs downstream from the initiation of exon 2. Table 3 shows the distribution of the prepro-orexin g1182C>T polymorphism genotypes and alleles in 2 groups. Genotype frequencies of polymorphisms in either OSAHS or control groups were in Hardy-Weinberg equilibrium (P > .05), which suggested that the study sample came from a general population, without any effects of natural selection or migration. Statistical analysis showed that there were significant differences in the genotype distribution between patients with OSAHS and the control group (χ22 = 6.437, P = .04). Variant allele T of the g1182C>T polymorphism was more commonly found in patients with OSAHS as compared with control subjects (χ21 = 5.648; P = .017; odds ratio [OR], 1.449; 95% confidence interval, 1.0466–1.968).
Table 3. Frequencies of genotypes and alleles of the polymorphism in prepro-orexin gene in patients with OSAHS and control subjects
Genotype HWE P Allele
C/C C/T T/T C T
OSAHS (n = 217) 85 (39.2) 112 (51.6) 20 (9.2) .347 282 (65.0) 152 (35.0)
Control (n = 177) 91 (51.4) 76 (42.9) 10 (5.6) .709 258 (72.9) 96 (27.1)
χ2 6.437 5.648
P .04 .017
OR⁎ 1.449 (1.066–1.968)
Data are presented as n (%). χ2 Analysis (R × C contingency table). HWE indicates Hardy-Weinberg equilibrium.
⁎ OR: for the the T allele.
3.3. Frequencies of genotypes between subgroups classified by BMI
The standard Cochran-Mantel-Haenszel χ2 test was used to test for association between SNP and OSAHS in an attempt to control for differences in BMI between the 2 groups. All 394 subjects were classified into 2 subgroups according to a BMI cutoff point of 30 kg/m2: obese subjects (BMI, >30 kg/m2; n = 110) and nonobese subjects (BMI, <30 kg/m2; n = 284). Results of the analysis also indicated a strong association between the SNP and OSAHS while controlling for BMI (χ2 = 5.412; P = .020; common OR,1.643; 95% confidence interval, 1.1–2.455) (Table 4).
Table 4. Frequencies of genotypes of the prepro-orexin gene polymorphism between subgroups classified by BMI within subjects
Nonobese subjects Obese subjects
OSAHS Control Total OSAHS Control Total
C/T+T/T 83 (51.23) 79 (48.77) 162 49 (87.5) 7 (12.5) 56
C/C 47 (38.5) 75 (61.5) 122 38 (70.37) 16 (29.63) 54
χ2 4.529 4.878
P 0.033 0.027
OR 1.677 (1.04–2.702) 2.947 (1.102–7.885)
Cochran
χ21 5.911
P .015
Mantel-Haenszel
χ21 5.412
P .020
Common OR 1.643 (1.1–2.455)
Data are presented as n (%); obese subjects (BMI, >30 kg/m2) and nonobese subjects (BMI, <30 kg/m2).
We also performed direct sequencing analysis of the promoter/exon-1 region in patients with OSAHS and healthy controls. No other polymorphisms were found in any subject.
4. Discussion
The present study is the first report on the association of OSAHS with g1182C>T, a genetic variant in the exon 2 of the prepro-orexin gene. Both genotype (C/T) and allele (T) of the g1182C>T SNP have significant association with OSAHS.
The prepro-orexin gene, on human chromosome 17q21–22, consists of 2 exons and 1 intron. Exon 2 encodes a propeptide from which the orexins A and B are cleaved proteolytically [24]. The pleiotropic effects of orexin are not only on appetite regulation but also on sleep architecture [25]. The prepro-orexin gene is expressed in a variety of brain areas that are important for the regulation of breathing, and the roles of orexin in neural control of the sleep-wake cycle have direct implications in OSAHS. The previous studies on orexin knockout mice have shed light on a direct role of orexin in cardiorespiratory control [18]. Orexin knockout mice show an excessive daytime sleepiness phenotype with instability in their arousal states [26] and exaggerated sleep apneas [27]. Besides an attenuated hypercapnic chemoreflex [28], orexin deficiency in mice impairs long-term facilitation of respiratory motor outputs in response to intermittent hypoxia [29].
In addition, orexin may exert a control of the genioglossus muscle activity that has a major role in OSAHS. Animal studies showed that orexin neurons can excite hypoglossal motoneurons through direct projections. In addition, hypoglossal premotoneurons have been identified in the Kölliker-Fuse [30], and orexin B microinjected in the Kölliker-Fuse nucleus enhances preinspiratory activity of the hypoglossal nerve [31]. Therefore, orexin deficiency can result in decreased excitability of genioglossus motoneurons; and lacking orexin excitatory drive to hypoglossal premotoneurons in the Kölliker-Fuse nucleus could diminish the preinspiratory protrusion of the tongue, which is physiologically required to reduce upper airway resistance before the active inspiratory phase. This can undoubtedly increase the risk of hypoglossal-related upper airway obstruction in orexin knockout mice.
Although the association between prepro-orexin g1128C>T and OSAHS appears solid, its functional implications are currently poorly understood. It is entirely unclear whether this C/T nucleotide exchange substitution affects ligand binding, effector coupling, or desensitization of the orexins A and B. A careful analysis of the prepro-orexin gene and the definition of haplotypes are required to further investigate the functional significance of this polymorphism.
Because all of our subjects were assessed by overnight PSG, an established diagnostic method for OSAHS, we assume these findings are valid. However, some issues need to be addressed. First, although the association with the prepro-orexin gene is based on an SNP in the translated region, how this SNP or its adjacent region relates to OSAHS is difficult to understand at this stage and requires further study. Second, we did not find the other SNP in prepro-orexin gene, including IVS1+16T>C, rs9902709, −909T/C, −22C/T and −20C/A polymorphisms, which were identified in previous studies [32], [33] and [34]. A possible reason for the discrepant results may be the difference of the studied racial populations. Further studies on orexin in larger populations and different races of people, as well as animal studies, if animal models of sleep apnea-hypopnea syndrome are available, would help to clarify the fact on orexin system in patients with OSAHS.
In conclusion, our finding of a genetic variant in the prepro-orexin gene provides a new possible candidate gene for OSAHS. Further work is required to study the extent of the haplotype in prepro-orexin gene involved. Additional replication in larger samples is necessary, including comparison with ongoing genome-wide association studies. The identification of a significant association between the prepro-orexin gene and OSAHS, with possible involvement in excessive daytime sleepiness, ventilator control, and upper airway patency, may have important clinical implications and warrants further study of the orexin in OSAHS.
Acknowledgments
Author contributions: Demin Han, conception, design, acquisition of data, analysis, interpretation, drafting, final approval; Weihu Chen, acquisition of data, analysis, final approval, manuscript preparation; Jingying Ye, design, acquisition of data, analysis, final approval, manuscript preparation; Guoping Yin, acquisition of data, final approval; Boxuan Wang, acquisition of data, final approval; Yuhuan, Zhang, acquisition of data, final approval.
The authors thank the laboratory staff of the Chinese National Human Genome Center, Beijing, China.
This work was supported by the National Natural Science Foundation of China (Grant no. 30730100).
Financial/nonfinancial disclosures: The authors have reported to the American College of Chest Physicians that no significant conflicts of interest exist with any companies/organizations whose products or services may be discussed in this article.
References
[1] T. Young, M. Palta and J. Dempsey, et al. The occurrence of sleep-disordered breathing among middle-aged adults. N Engl J Med, 328 (1993), pp. 1230–1235. | View Record in Scopus | | Cited By in Scopus (4017)
[2] C. Gilleminault and R. Pelayo, Sleep-disordered breathing in children. Ann Med, 30 (1998), pp. 350–356.
[3] J.P. Janssens, S. Pautex and H. Hilleret, et al. Sleep disordered breathing in the elderly. Aging, 12 (2000), pp. 417–429. | View Record in Scopus | | Cited By in Scopus (28)
[4] A. Barcelo, M.A. Elorza and F. Barbe, et al. Angiotensin converting enzyme in patients with sleep apnoea syndrome: plasma activity and gene polymorphisms. Eur Respir J, 17 (2001), pp. 728–732. | View Record in Scopus | | Cited By in Scopus (28)
[5] L.J. Palmer, S.G. Buxbaum and E.K. Larkin, et al. Whole genome scan for obstructive sleep apnea and obesity in African-American families. Am J Respir Crit Care Med, 169 (2004), pp. 1314–1321.
[6] K. Sakai, T. Takada and H. Nakayama, et al. Serotonin-2A and 2C receptor gene polymorphisms in Japanese patients with obstructive sleep apnea. Intern Med, 44 (2005), pp. 928–933.
[7] R.L. Riha, P. Brander and M. Vennelle, et al. Tumour necrosis factor-alpha (-308) gene polymorphism in obstructive sleep apnoeaehypopnoea syndrome. Eur Respir J, 26 (2005), pp. 673–678.
[8] L. De Lecea, T.S. Kilduff and C. Peyron, et al. The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A, 95 (1998), pp. 322–327.
[9] T. Sakurai, A. Amemiya and M. Ishii, et al. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G-coupled receptors that regulate feeding behavior. Cell, 92 (1998), pp. 573–585.
[10] C. Peyron, D.K. Tighe and A.N. van den Pol, et al. Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci, 18 (1998), pp. 9996–10015.
[11] J.P. Nixon and S. Smale, A comparative analysis of the distribution of immunoreactive orexin A and B in the brains of nocturnal and diurnal rodents. Behav Brain Funct, 3 (2007), p. 28.
[12] K. Yoshida, S. McCormack and R.A. Espanña, et al. Afferents to the orexin neurons of the rat brain. J Comp Neurol, 494 (2006), pp. 845–861.
[13] T. Sakurai, R. Nagata and A. Yamanaka, et al. Input of orexin/hypocretin neurons revealed by a genetically encoded tracer in mice. Neuron, 46 (2005), pp. 297–308.
[14] N.C. Tkacs, Y. Pan and G. Sawhney, et al. Hypoglycemia activates arousal-related neurons and increases wake time in adult rats. Physiol Behav, 91 (2007), pp. 240–249.
[15] H. Ganjavi and C.M. Shapiro, Hypocretin/orexin: a molecular link between sleep, energy regulation, and pleasure. J Neuropsychiatry Clin Neurosci, 19 (2007), pp. 413–419.
[16] K. Ohno and T. Sakurai, Orexin neuronal circuitry: role in the regulation of sleep and wakefulness. Front Neuroendocrinol, 29 (2008), pp. 70–87.
[17] C.G. Diniz Behn, N. Kopell and E.N. Brown, et al. Delayed orexin signaling consolidates wakefulness and sleep: physiology and modeling. J Neurophysiol, 99 (2008), pp. 3090–3103.
[18] T. Kuwaki, W. Zhang and A. Nakamura, et al. Emotional and state-dependent modification of cardiorespiratory function: role of orexinergic neurons. Auton Neurosci, 142 (2008), pp. 11–16.
[19] T. Kuwaki, Orexinergic modulation of breathing across vigilance states. Respir Physiol Neurobiol, 164 (2008), pp. 204–212.
[20] S. Nishino, Clinical and neurobiological aspects of narcolepsy. Sleep Med, 8 (2007), pp. 373–399.
[21] T. Nishijima, S. Sakurai and Z. Arihara, et al. Plasma orexin-A–like immunoreactivity in patients with sleep apnea hypopnea syndrome. Peptides, 24 (2003), pp. 407–411.
[22] S. Sakurai, T. Nishijima and S. Takahashi, et al. Clinical significance of daytime plasma orexin-A–like immunoreactivity concentrations in patients with obstructive sleep apnea hypopnea syndrome. Respiration, 71 (2004), pp. 380–384.
[23] X. Busquets, F. Barbe and A. Barcelo, et al. Decreased plasma levels of orexin-A in sleep apnea. Respiration, 71 (2004), pp. 575–579.
[24] T. Sakurai, T. Moriguchi and K. Furuya, et al. Structure and function of human prepro-orexin gene. J Biol Chem, 74 (1999), pp. 17771–17776.
[25] J. Lu, D. Sherman and M. Devor, et al. A putative flip-flop switch for control of REM sleep. Nature, 441 (2006), pp. 589–594.
[26] T. Mochizuki, A. Crocker and S. McCormack, et al. Behavioral state instability in orexin knockout mice. J Neurosci, 24 (2004), pp. 6291–6300.
[27] A. Nakamura, W. Zhang and M. Yanagisawa, et al. Vigilance state-dependent attenuation of chemoreflex and exaggerated sleep apnea in orexin knockout mice. J Appl Physiol, 102 (2007), pp. 241–248.
[28] B.S. Deng, A. Nakamura and W. Zhang, et al. Contribution of orexin in hypercapnic chemoreflex: evidence from genetic and pharmacological disruption and supplementation studies in mice. J Appl Physiol, 103 (2007), pp. 1772–1779.
[29] J. Terada, A. Nakamura and W. Zhang, et al. Ventilatory long-term facilitation in mice can be observed both during sleep and wake periods and depends on orexin. J Appl Physiol, 104 (2008), pp. 499–507. | View Record in Scopus | | Cited By in Scopus (27)
[30] C. Gestreau, M. Dutschmann and S. Obled, et al. Activation of hypoglossal motor and premotor neurons during various oropharyngeal behaviors. Respir Physiol Neurobiol, 147 (2005), pp. 159–176. Article | PDF (643 K) | | View Record in Scopus | | Cited By in Scopus (40)
[31] M. Dutschmann, M. Kron and M. Mörschel, et al. Activation of orexin B receptors in the pontine Kölliker-Fuse nucleus modulates preinspiratory hypoglossal motor activity in rat. Respir Physiol Neurobiol, 159 (2007), pp. 232–235. Article | PDF (352 K) | | View Record in Scopus | | Cited By in Scopus (15)
[32] M. Hungs, L. Lin and M. Okun, et al. Polymorphisms in the vicinity of the hypocretin/orexin gene are not associated with human narcolepsy. Neurology, 57 (2001), pp. 1893–1895. | View Record in Scopus | | Cited By in Scopus (30)
[33] M. Gencik, N. Dahmen and S. Wieczorek, et al. A prepro-orexin gene polymorphism is associated with narcolepsy. Neurology, 56 (2001), pp. 115–117. | View Record in Scopus | | Cited By in Scopus (42)
[34] I. Rissling, Y. Körner and F. Geller, et al. Preprohypocretin polymorphisms in Parkinson disease patients reporting “sleep attacks”. Sleep, 28 (2005), pp. 871–875. | View Record in Scopus | | Cited By in Scopus (15)
☆The source of financial support: This work was supported by the National Natural Science Foundation of China (Grant no. 30730100).
Corresponding Author Contact InformationCorresponding author. Department of Otorhinolaryngology, Head and Neck Surgery, Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, Beijing 100730, China. Tel.: +86 10 58265782; fax: +86 10 65131244.
1Co–first author: Chen Weihu, MD, and Ye Jingying, MD, contributed equally to this work.
American Journal of Otolaryngology
Volume 33, Issue 1, January-February 2012, Pages 31-36
lunes, 28 de noviembre de 2011
jueves, 24 de noviembre de 2011
'Tinnitus freaked me out - I heard sinister sounds'
Andrew Goodwin's definition of his tinnitus is frank.
"It's a noise I can't identify which freaks me out."
He first began to hear a weird, piercing noise in his ears aged 31. On the same day in 2002, Andrew became profoundly deaf.
It was a terrifying and lonely time for him. Eighteen months later he discovered hearing aids which were powerful enough to help him hear again, but the tinnitus remained.
The noise he hears, but which no one else can, takes on a different character depending on how Andrew is feeling.
"When I am stressed it sounds like wind rushing through the trees. But at night after a long day it can be sinister. It sounds like there are voices, whispering..."
"Initially I didn't know what it was or where it was coming from. I thought I was going mad," he says.
Five million people in the UK are thought to live with tinnitus, but not all suffer from hearing loss as well.
The British Tinnitus Association says that about 10% of the UK adult population have mild tinnitus all the time and, in up to 1% of adults, this may affect their quality of life.
Tinnitus is the perception of sound in the absence of any actual, corresponding external sound and it can occur at any age - even in quite young children.
Although the precise cause of tinnitus is still not fully understood, experts say there are certain things which should be avoided.
Continue reading the main story
“Start Quote
Loud music is fun but we must be careful too.”
Dr David Baguley CAmbridge University Hospitals
David Baguley, consultant clinical scientist at Cambridge University Hospitals and vice chairman of the British Tinnitus Association, urges care around loud music.
"Intense sound can cause changes to the hearing system and can then lead to tinnitus. Loud music is fun but we must be careful too."
The ear is an extremely sensitive organ which has to deal with a massive range of sound levels - from a whisper at 30 decibels to a busy bar at 80-90 dB and a noisy club at 100 dB or more.
This sort of noise level is thought to be "safe" for fewer than 30 minutes.
Conrad Jarvis was listening to music two years ago when he suddenly heard a "crackling" noise in his left ear.
He initially put it down to the new headphones he was wearing before he realised there had been a permanent change in his hearing.
At first he did not notice the tinnitus.
Conrad Jarvis Conrad's hearing aid has helped him cope with tinnitus and continue working as a DJ
"It just came on... this high-pitched sound. It was constantly there, sometimes it changed in pitch. It did drive me crazy," he says.
As a DJ who played everything from soul to R&B and house music, often at high volumes, Conrad thought his music career was finished.
But he was persuaded to have an operation and then use a hearing aid, which is now the only thing that quietens the tinnitus.
"After lots of hearing tests I realised my ear drum was damaged - so I just knew that was it for the rest of my life."
He was very reluctant to wear a big, pink hearing aid - particularly as he is of Caribbean descent - but he managed to get a small, brown digital hearing aid which most of his friends mistake for a blue tooth device.
"I've got back my sense of balance on my left-hand side and the hearing aid has reduced the tinnitus dramatically," Conrad says.
Continue reading the main story
“Start Quote
After a long, tiring day, tinnitus is my way of telling me to slow down.”
Andrew Goodwin
There are various treatments available which can help people deal with tinnitus. These include hearing aids, relaxation techniques to try to reduce anxiety levels and a bedside sound generator which produces the sound of rain, the ocean or birds to help induce sleep.
"For those seriously affected by tinnitus, psychological therapy in the form of cognitive behavioural therapy can be tried," Dr Baguley says.
Andrew Goodwin took up the relaxation technique Tai Chi to help him deal with his tinnitus, which he found very successful.
"The breathing exercises helped me relax and that calmed down the tinnitus," he says.
Stress and anxiety can also affect tinnitus levels, as Andrew testifies.
"If I get stressed, my tinnitus gets worse. After a long, tiring day, tinnitus is my way of telling me to slow down."
Current research on tinnitus is focusing on drugs which could have affect the intensity of the tinnitus, and on the use of filtered music to reduce the sound of the tinnitus.
Research is also being carried out into how the activity of the brain can be influenced using magnetism or electrical stimulation. This research is at a more experimental stage, says Dr Baguley.
Andrew's experience led him to become information and outreach advisor for Deafness Research UK. His job is to tour the country talking to people about how to look after their hearing and advising them on how to cope with hearing loss and tinnitus.
His advice on tinnitus is simple: "Talk to someone about it. There is help. You can't cure it but you can make it manageable."
Fuente: http://www.bbc.co.uk/news/health-12698862
"It's a noise I can't identify which freaks me out."
He first began to hear a weird, piercing noise in his ears aged 31. On the same day in 2002, Andrew became profoundly deaf.
It was a terrifying and lonely time for him. Eighteen months later he discovered hearing aids which were powerful enough to help him hear again, but the tinnitus remained.
The noise he hears, but which no one else can, takes on a different character depending on how Andrew is feeling.
"When I am stressed it sounds like wind rushing through the trees. But at night after a long day it can be sinister. It sounds like there are voices, whispering..."
"Initially I didn't know what it was or where it was coming from. I thought I was going mad," he says.
Five million people in the UK are thought to live with tinnitus, but not all suffer from hearing loss as well.
The British Tinnitus Association says that about 10% of the UK adult population have mild tinnitus all the time and, in up to 1% of adults, this may affect their quality of life.
Tinnitus is the perception of sound in the absence of any actual, corresponding external sound and it can occur at any age - even in quite young children.
Although the precise cause of tinnitus is still not fully understood, experts say there are certain things which should be avoided.
Continue reading the main story
“Start Quote
Loud music is fun but we must be careful too.”
Dr David Baguley CAmbridge University Hospitals
David Baguley, consultant clinical scientist at Cambridge University Hospitals and vice chairman of the British Tinnitus Association, urges care around loud music.
"Intense sound can cause changes to the hearing system and can then lead to tinnitus. Loud music is fun but we must be careful too."
The ear is an extremely sensitive organ which has to deal with a massive range of sound levels - from a whisper at 30 decibels to a busy bar at 80-90 dB and a noisy club at 100 dB or more.
This sort of noise level is thought to be "safe" for fewer than 30 minutes.
Conrad Jarvis was listening to music two years ago when he suddenly heard a "crackling" noise in his left ear.
He initially put it down to the new headphones he was wearing before he realised there had been a permanent change in his hearing.
At first he did not notice the tinnitus.
Conrad Jarvis Conrad's hearing aid has helped him cope with tinnitus and continue working as a DJ
"It just came on... this high-pitched sound. It was constantly there, sometimes it changed in pitch. It did drive me crazy," he says.
As a DJ who played everything from soul to R&B and house music, often at high volumes, Conrad thought his music career was finished.
But he was persuaded to have an operation and then use a hearing aid, which is now the only thing that quietens the tinnitus.
"After lots of hearing tests I realised my ear drum was damaged - so I just knew that was it for the rest of my life."
He was very reluctant to wear a big, pink hearing aid - particularly as he is of Caribbean descent - but he managed to get a small, brown digital hearing aid which most of his friends mistake for a blue tooth device.
"I've got back my sense of balance on my left-hand side and the hearing aid has reduced the tinnitus dramatically," Conrad says.
Continue reading the main story
“Start Quote
After a long, tiring day, tinnitus is my way of telling me to slow down.”
Andrew Goodwin
There are various treatments available which can help people deal with tinnitus. These include hearing aids, relaxation techniques to try to reduce anxiety levels and a bedside sound generator which produces the sound of rain, the ocean or birds to help induce sleep.
"For those seriously affected by tinnitus, psychological therapy in the form of cognitive behavioural therapy can be tried," Dr Baguley says.
Andrew Goodwin took up the relaxation technique Tai Chi to help him deal with his tinnitus, which he found very successful.
"The breathing exercises helped me relax and that calmed down the tinnitus," he says.
Stress and anxiety can also affect tinnitus levels, as Andrew testifies.
"If I get stressed, my tinnitus gets worse. After a long, tiring day, tinnitus is my way of telling me to slow down."
Current research on tinnitus is focusing on drugs which could have affect the intensity of the tinnitus, and on the use of filtered music to reduce the sound of the tinnitus.
Research is also being carried out into how the activity of the brain can be influenced using magnetism or electrical stimulation. This research is at a more experimental stage, says Dr Baguley.
Andrew's experience led him to become information and outreach advisor for Deafness Research UK. His job is to tour the country talking to people about how to look after their hearing and advising them on how to cope with hearing loss and tinnitus.
His advice on tinnitus is simple: "Talk to someone about it. There is help. You can't cure it but you can make it manageable."
Fuente: http://www.bbc.co.uk/news/health-12698862
Allergic to sound: The debilitating condition, suffered by thousands of Britons, that makes everyday noise excruciatingly loud
By Isla Whitcroft
8th March 2011
Standing in the shower, musician Chris Singleton flinched as he turned the tap on to full. ‘I knew what was coming,’ he says. ‘If I was lucky, I could bear ten seconds under the water before the urge to switch it off became overwhelming.
‘Flushing the loo was even more scary. I became adept at pushing down the handle and then running for the door.’
Chris, 33, was not struggling with an aversion to bathrooms or a water phobia. Rather, he was suffering from hyperacusis — acute sensitivity to sound.
Shhhhh: For those who suffer from hyperacusis, just the sound of a loo flushing can be excruciating
Shhhhh: For those who suffer from hyperacusis, just the sound of a loo flushing can be excruciating
‘It was like a bad joke,’ says Chris ruefully. ‘A rock musician who is allergic to loud noises. But it was actually a nightmare. The sound of certain noises — such as the toilet flushing or the telephone ringing — was actually physically painful.
‘The pain was sharp, the sort of discomfort people with normal hearing would feel if they heard the high-pitched squeal of microphone feedback.’
Hyperacusis is a hypersensitivity to certain sounds at a volume that others find normal, explains Dr Veronica Kennedy, a specialist at NHS Bolton.
Me and my operation: Sucking the jelly out of my eyeballs made my annoying floaters vanish
Balloon in your tum that helps you lose weight
‘Which sounds become painful varies from person to person,’ she says. ‘For some people, the problem may be occasional and fairly mild, but for others it can become extremely life-limiting — to the point where they stop going out and gear their entire life around being in as quiet an environment as possible.’
Experts estimate that between two and five per cent of the adult population will suffer from hyperacusis at some point, but are unclear why it occurs.
‘There are theories that it can be triggered by exposure to a sudden loud noise or it may be linked to a stressful event or a trauma, such as an accident,’ says Dr Kennedy. But in all cases the effect is the same: the internal hearing level is reset.
Chris first noticed something was wrong in early 2004, when his left ear started to feel full, as if he had been swimming and it had fluid in it. ‘After a couple of weeks, I went to see my GP, who said that there was a hole in my eardrum and gave me antibiotics,’ he says.
Like a bad joke: For rock musician Chris Singleton, being allergic to loud noises has been a nightmare
Like a bad joke: For rock musician Chris Singleton, being allergic to loud noises has been a nightmare
‘It healed within a couple of weeks, but by then I was starting to find certain noises — particularly high-pitched ones — painful. And not just in my left ear; my right ear was behaving strangely, too.’
Chris adds: ‘This started to have a subtle effect on my behaviour. When getting on a train, I would always look for the loudspeakers which announced the station names, and find a seat as far away as possible; in cafes, I had to avoid going near the espresso machine.
‘At that stage, the sound of people talking at a normal level was OK, although this changed later on. But bars and clubs became a no-go area without earplugs.
‘The problem was that when I took the plugs out, everything seemed much louder.’
In fact, while many people with hyperacusis wear earplugs, it’s the worst thing they can do. Dr Kennedy explains: ‘When you hear a sound, your brain interprets what level it is at, then translates that so you can hear it properly.
‘If the sound is muffled because you’re wearing earplugs, the brain simply turns up the internal volume so the sound is audible.
‘Then, when you take the earplugs out, everyday sounds are even louder, so you wear the earplugs more often and your brain turns up the internal volume again. It’s a vicious circle.’
A more fundamental problem is lack of awareness of hyperacusis among the general public and even within the medical profession, says Dr Kennedy.
‘Often, people are initially misdiagnosed as having ear infections, sinus problems and, most commonly, tinnitus. This, of course, can lead to distress for the patients who have to live day-to-day with what can be a very miserable condition.’
Hyperacusis is most likely triggered by physical causes like a head injury or overexposure to loud noise. But anxiety plays a big part, too
Hyperacusis is most likely triggered by physical causes like a head injury or overexposure to loud noise. But anxiety plays a big part, too
As Chris was to discover. During the first few months, he went back to his GP several times and saw two private ear, nose and throat consultants who all said there was nothing wrong.
After four months, he was ‘desperate’. ‘Most musicians love the sound of their own voice, but I couldn’t bear mine. I was recording my first album and had to turn the volume down very low and wear earplugs.’
His personal life was also suffering. ‘I became extremely irritable and a nightmare to live with. My relationship with my girlfriend suffered considerably — she had to tiptoe whenever I was around. It led to rows where both of us had to whisper at each other as shouting was out of the question.’
Chris turned to the internet, and discovered his problem was hyperacusis. ‘Although it was a relief to work out what was wrong, there were some pretty upsetting stories about people who had been driven almost to suicide,’ he says.
‘I never got that bad, although at one point I did consider going on anti-depressants.’
However, when he saw another private consultant, who prescribed an anti-anxiety drug with strong side-effects, Chris decided against taking it.
By then, he was living in London, and was referred to an NHS consultant at Barts and The London NHS Trust. ‘He couldn’t have been more different from the others — he actually listened to me,’ says Chris.
After four months, I was desperate. Most musicians love the sound of their own voice, but I couldn’t bear mine
‘He gave me tests to determine just how bad my hyperacusis was. He explained that much of what I was experiencing was anxiety related. Hyperacusis is most likely triggered by physical causes — for example, a head injury or overexposure to loud noise. But anxiety plays a big part, too.
‘Because of this he said my hearing would benefit from psychological therapy. I thought the idea quite funny but, unbelievably, it worked.’
Explains Chris: ‘Once the therapist was able to reassure me there was absolutely nothing wrong with my hearing and that loud noises — as long as they weren’t ridiculously loud — were perfectly within the range of the coping mechanism of the human ear, I stopped being frightened of them.’
He gave up his earplugs, which was hard for a few weeks because noises were very loud. But about six weeks after first seeing the consultant, he was able to sit in a bar without a problem. ‘It was a wonderful moment. I felt normal again,’ says Chris.
Dr Kennedy explains: ‘If you can get the patient to understand the link between the hyperacusis and the anxiety, and give them a few pointers to deal with those issues, the problems can be solved sometimes surprisingly quickly.’ Hyperacusis can also be treated with de-sensitisation, where noise is played at gradually increasing volumes to readjust the patient’s hearing to everyday volumes.
While he considers himself cured, Chris — who has just released his second album, Lady Gasoline — admits there are still times, usually when he is tired or stressed, that loud noises can start to irritate him.
‘When this happens, I take a grip of myself, if you like,’ he says. ‘But I am annoyed that to get to this stage I had to see three GPs, three consultants, three nurses, two trainee hearing therapists and a hearing therapist.
‘The emotional cost had been huge, too. I nearly gave up on my music and my girlfriend.
‘Eventually, I got very good help from the medical profession, but if there was more knowledge about hyperacusis I am sure I could have got better much quicker — and avoided all those whispered fights with my girlfriend!’
Lady Gasoline is out on IRL/Proper and can be bought on iTunes; www.chrissingletonmusic.com
Fuente: http://www.dailymail.co.uk/health/article-1363993/Allergic-sound-The-debilitating-condition-suffered-thousands-Britons-makes-everyday-noise-excruciatingly-loud.html#ixzz1eh2nwk7w
8th March 2011
Standing in the shower, musician Chris Singleton flinched as he turned the tap on to full. ‘I knew what was coming,’ he says. ‘If I was lucky, I could bear ten seconds under the water before the urge to switch it off became overwhelming.
‘Flushing the loo was even more scary. I became adept at pushing down the handle and then running for the door.’
Chris, 33, was not struggling with an aversion to bathrooms or a water phobia. Rather, he was suffering from hyperacusis — acute sensitivity to sound.
Shhhhh: For those who suffer from hyperacusis, just the sound of a loo flushing can be excruciating
Shhhhh: For those who suffer from hyperacusis, just the sound of a loo flushing can be excruciating
‘It was like a bad joke,’ says Chris ruefully. ‘A rock musician who is allergic to loud noises. But it was actually a nightmare. The sound of certain noises — such as the toilet flushing or the telephone ringing — was actually physically painful.
‘The pain was sharp, the sort of discomfort people with normal hearing would feel if they heard the high-pitched squeal of microphone feedback.’
Hyperacusis is a hypersensitivity to certain sounds at a volume that others find normal, explains Dr Veronica Kennedy, a specialist at NHS Bolton.
Me and my operation: Sucking the jelly out of my eyeballs made my annoying floaters vanish
Balloon in your tum that helps you lose weight
‘Which sounds become painful varies from person to person,’ she says. ‘For some people, the problem may be occasional and fairly mild, but for others it can become extremely life-limiting — to the point where they stop going out and gear their entire life around being in as quiet an environment as possible.’
Experts estimate that between two and five per cent of the adult population will suffer from hyperacusis at some point, but are unclear why it occurs.
‘There are theories that it can be triggered by exposure to a sudden loud noise or it may be linked to a stressful event or a trauma, such as an accident,’ says Dr Kennedy. But in all cases the effect is the same: the internal hearing level is reset.
Chris first noticed something was wrong in early 2004, when his left ear started to feel full, as if he had been swimming and it had fluid in it. ‘After a couple of weeks, I went to see my GP, who said that there was a hole in my eardrum and gave me antibiotics,’ he says.
Like a bad joke: For rock musician Chris Singleton, being allergic to loud noises has been a nightmare
Like a bad joke: For rock musician Chris Singleton, being allergic to loud noises has been a nightmare
‘It healed within a couple of weeks, but by then I was starting to find certain noises — particularly high-pitched ones — painful. And not just in my left ear; my right ear was behaving strangely, too.’
Chris adds: ‘This started to have a subtle effect on my behaviour. When getting on a train, I would always look for the loudspeakers which announced the station names, and find a seat as far away as possible; in cafes, I had to avoid going near the espresso machine.
‘At that stage, the sound of people talking at a normal level was OK, although this changed later on. But bars and clubs became a no-go area without earplugs.
‘The problem was that when I took the plugs out, everything seemed much louder.’
In fact, while many people with hyperacusis wear earplugs, it’s the worst thing they can do. Dr Kennedy explains: ‘When you hear a sound, your brain interprets what level it is at, then translates that so you can hear it properly.
‘If the sound is muffled because you’re wearing earplugs, the brain simply turns up the internal volume so the sound is audible.
‘Then, when you take the earplugs out, everyday sounds are even louder, so you wear the earplugs more often and your brain turns up the internal volume again. It’s a vicious circle.’
A more fundamental problem is lack of awareness of hyperacusis among the general public and even within the medical profession, says Dr Kennedy.
‘Often, people are initially misdiagnosed as having ear infections, sinus problems and, most commonly, tinnitus. This, of course, can lead to distress for the patients who have to live day-to-day with what can be a very miserable condition.’
Hyperacusis is most likely triggered by physical causes like a head injury or overexposure to loud noise. But anxiety plays a big part, too
Hyperacusis is most likely triggered by physical causes like a head injury or overexposure to loud noise. But anxiety plays a big part, too
As Chris was to discover. During the first few months, he went back to his GP several times and saw two private ear, nose and throat consultants who all said there was nothing wrong.
After four months, he was ‘desperate’. ‘Most musicians love the sound of their own voice, but I couldn’t bear mine. I was recording my first album and had to turn the volume down very low and wear earplugs.’
His personal life was also suffering. ‘I became extremely irritable and a nightmare to live with. My relationship with my girlfriend suffered considerably — she had to tiptoe whenever I was around. It led to rows where both of us had to whisper at each other as shouting was out of the question.’
Chris turned to the internet, and discovered his problem was hyperacusis. ‘Although it was a relief to work out what was wrong, there were some pretty upsetting stories about people who had been driven almost to suicide,’ he says.
‘I never got that bad, although at one point I did consider going on anti-depressants.’
However, when he saw another private consultant, who prescribed an anti-anxiety drug with strong side-effects, Chris decided against taking it.
By then, he was living in London, and was referred to an NHS consultant at Barts and The London NHS Trust. ‘He couldn’t have been more different from the others — he actually listened to me,’ says Chris.
After four months, I was desperate. Most musicians love the sound of their own voice, but I couldn’t bear mine
‘He gave me tests to determine just how bad my hyperacusis was. He explained that much of what I was experiencing was anxiety related. Hyperacusis is most likely triggered by physical causes — for example, a head injury or overexposure to loud noise. But anxiety plays a big part, too.
‘Because of this he said my hearing would benefit from psychological therapy. I thought the idea quite funny but, unbelievably, it worked.’
Explains Chris: ‘Once the therapist was able to reassure me there was absolutely nothing wrong with my hearing and that loud noises — as long as they weren’t ridiculously loud — were perfectly within the range of the coping mechanism of the human ear, I stopped being frightened of them.’
He gave up his earplugs, which was hard for a few weeks because noises were very loud. But about six weeks after first seeing the consultant, he was able to sit in a bar without a problem. ‘It was a wonderful moment. I felt normal again,’ says Chris.
Dr Kennedy explains: ‘If you can get the patient to understand the link between the hyperacusis and the anxiety, and give them a few pointers to deal with those issues, the problems can be solved sometimes surprisingly quickly.’ Hyperacusis can also be treated with de-sensitisation, where noise is played at gradually increasing volumes to readjust the patient’s hearing to everyday volumes.
While he considers himself cured, Chris — who has just released his second album, Lady Gasoline — admits there are still times, usually when he is tired or stressed, that loud noises can start to irritate him.
‘When this happens, I take a grip of myself, if you like,’ he says. ‘But I am annoyed that to get to this stage I had to see three GPs, three consultants, three nurses, two trainee hearing therapists and a hearing therapist.
‘The emotional cost had been huge, too. I nearly gave up on my music and my girlfriend.
‘Eventually, I got very good help from the medical profession, but if there was more knowledge about hyperacusis I am sure I could have got better much quicker — and avoided all those whispered fights with my girlfriend!’
Lady Gasoline is out on IRL/Proper and can be bought on iTunes; www.chrissingletonmusic.com
Fuente: http://www.dailymail.co.uk/health/article-1363993/Allergic-sound-The-debilitating-condition-suffered-thousands-Britons-makes-everyday-noise-excruciatingly-loud.html#ixzz1eh2nwk7w
Punk rock: Anarchy in the UK tribute tour in Caerphilly
A 35th anniversary recreation of a controversial punk concert leaves BBC Wales' Nick Horton feeling nostalgic, not too embarrassed, and with gratifying ringing in the ears.
One of the posters at the back of the Caerphilly Workingmen's Hall read: "Punk's not dead".
Well, maybe not. But like many of the 150 or so who dragged our aching bones out for this gentle jog - it's the liveliest exertion most of us can manage - down a rowdy memory lane, it's certainly showing its age.
Here's why we were there: in winter 1976, Caerphilly was the south Wales destination for the Anarchy in the UK tour, headlined by the Sex Pistols, and including The Clash, and Johnny Thunders and the Heartbreakers.
But this was no ordinary rock show. The Pistols, having recently sworn on tea-time telly, were at the height of their notoriety, many of the tour dates were cancelled, and protesters gathered to sing carols and pray for the misguided souls inside the town's Castle Cinema.
Only a few dozen were in the venue. But, like many of these infamous gigs, hundreds subsequently claimed to have pogoed the Caerphilly night away.
Mostly male
For 14-year-olds like me the 1976 gig had come a few months too soon, when this noisy musical fad was just a weird London obsession splashed over the tabloids, and Eddie and the Hot Rods were the nearest thing to punk I'd ever heard. And anyway, it was in the neighbouring valley, and therefore a million miles away.
Forward 35 years, and the 2011 version was the nearest we oldies were going to get to reliving something we never saw. Of course, they weren't the original bands, by virtue of many of their members unfortunately being dead.
But still. Here at least was one original: Billy Rath, the Heartbreakers' bassist, looking every inch the man who has enjoyed a full rock 'n' roll lifestyle, in his own tribute band, the Broken Hearts. After a classically chaotic start in the punk spirit, when Rath couldn't get his bass to emit a sound, they faithfully recreated the meat and potatoes cheap thrills the Heartbreakers imported from New York.
One rule of music writing always used to be: don't review the audience. But it's unavoidable in this case, because the crowd were integral to the show. Punk always was a mostly male preserve, and so it proved again in Caerphilly.
Leather-jacketed MC
Just like ye olden days, a bunch of boisterous blokes jumped around in front of the stage. While they included a few mohican-wearing twenty-somethings, they looked mostly middle-aged, portly and shiny-headed - yup, that'll be me, then - and you had to be brave to risk venturing into this anarchic moshpit. And, nope, that wasn't me.
One disappointment was the non-appearance of Ray Davies - no, not that one, Kinks fans - but the radical local councillor who had been among the 1976 protesters. But he later changed his mind, deciding he had no right to tell young people how to have fun, and had been due on stage to introduce the 2011 night.
But the leather-jacketed MC told us that Mr Davies couldn't make it. And again with real punk ethos, he started to explain the context of the show, before admitting he couldn't be bothered and made way for the bands.
Then came the undoubted highlight: Rebel Truce, the Clash tribute band. Until a few years ago I wouldn't have dreamed of going to see them out of embarrassment at trying to relive a long-gone past.
Pedantic punk historians
But thankfully I've cleared the shame hurdle, and Rebel Truce are everything you want from a tribute band. They play almost all the greatest songs - although with The Clash you'd need hours just to scratch the surface of their classic material - and manage to look and sound like them without descending into pastiche.
Which is more than you can say for the Sex Pistols Experience, the headline act. They were a faithful facsimile of the Pistols, with an uncannily accurate Johnny Rotten in his pre-butter salesman and I'm a Celebrity, Get Me Out of Here days, sneering: "Welcome to Cardiff's car park".
The Sid Vicious-alike was equally impressive, even mock-threatening to bash a fan with his bass at one point, although pedantic punk historians among us will point out that he never appeared at Caerphilly, when his Beatles-loving predecessor Glen Matlock was still in the band.
As powerful as they were, the Sex Pistols Experience came over as more of a cabaret act, emphasising why they were ultimately usurped by The Clash as the punk band who really mattered.
But reviewing the music on a night like this is, frankly, a little pointless. It was all about being there, and going home with a gratifying ringing in the ears from standing close to the speakers. Not too close these days, mind.
As someone who had notched up pretentious middle-class brownie points earlier in the day by searching for balsamic glaze and sour dough bread in Waitrose, it was a little unsettling to be thrown back to my O-level era.
Particularly as these days a wild time in my book amounts to searching B&Q for an allen key in the UK. OK, not my joke, but one I can't resist stealing.
Thankfully, the club had comfy seats to rest my weary limbs, and it was over not long after midnight. So punk's not dead. But punk is mostly for dads these days, just as it should be.
Fuente: http://www.bbc.co.uk/news/mobile/uk-wales-south-east-wales-15414685
miércoles, 23 de noviembre de 2011
Ruidos de nuestro planeta o del espacio exterior
El misterioso "zumbido" que se percibe en diversos países del mundo constituye un reto para estudiosos y resulta hoy un enigma aún no descifrado.
Denominado " Hum" en inglés, es básicamente el nombre genérico de un evento sonoro persistente e invasivo de baja frecuencia que no es escuchado por todas las personas ni puede ser evitado con audífonos, según afirma Robert Stask, de la revista Misterios sin resolver.
Todo comenzó en el poblado de Taos, en el estado de Nuevo México, y por eso muchos expertos lo llaman el "Zumbido de Taos", para poder registrarlo como un fenómeno que ya se experimenta en todos los continentes.
En Hawai, por ejemplo, el sonido es escuchado fundamentalmente por personas que lo describen como un motor de diesel acelerado; normalmente no se puede registrar con micrófonos, y su fuente y naturaleza son prácticamente imposibles de localizar.
Algunas personas escuchan el ruido dentro de sus hogares, pero no al aire libre y lo perciben como vibraciones en el cuerpo y no tanto en el tímpano, especialmente en horas de la noche; en tanto otras lo sienten continuamente y ciertos hombres y mujeres solamente en determinados momentos.
Varias reacciones a este evento pueden interferir seriamente con las actividades diarias y la salud humana, como son el insomnio, la ansiedad y otras alteraciones nerviosas, manifiesta el doctor Tom Moir, de la Universidad de Massey, en Nueva Zelanda.
HISTORIAL DEL EXTRAÑO SUCESO
Los primeros indicios del sonido aparecieron en la década de 1970 en Estados Unidos pero los expertos sólo los comenzaron a investigarlo con seriedad veinte años después, tras numerosas quejas de ciudadanos y autoridades locales.
Alrededor de esa misma fecha, otros individuos presentaron quejas similares en Nueva Zelanda y Reino Unido, pero nadie puede asegurar aún que se trata de un evento sonoro similar en los dos países.
En el caso del poblado de Kokomo, en el estado de Indiana, Estados Unidos, la existencia de grandes industrias pesadas hacen que los científicos consideren el ruido generado por dos grandes ventiladores de enfriamiento, ubicados en la fábrica de automóviles Chrysler, que emiten un elevado nivel sonoro.
El diario Albuquerque Journal publicó numerosos reportajes sobre este enigma donde se informa que muchos afectados lo relacionan con objetos voladores no identificados, con cuestiones de fantasmas, con trabajos de minería subterráneos secretos, con líneas de alto voltaje y con pruebas clandestinas de armamento nuclear a grandes profundidades.
Uno de los posibles orígenes del zumbido, apuntan otros investigadores, pudieran ser los procedimientos de comunicación de submarinos militares, tales como el ELF (Sistema de Frecuencias Extremadamente Bajas), que son capaces de atravesar la tierra y el mar en cualquier dirección.
Mientras, otra opción la representan los sistemas de calentamiento ionosféricas de muy alta frecuencia, llevados a cabo por Estados Unidos, Rusia y Noruega, tales como el denominado HAARP, desarrollado en Alaska desde 1993.
Hacia otro plano de las hipótesis, el "zumbido" podría ser provocado por factores naturales, como el movimiento de las placas terrestres, las ondas electromagnéticas causadas por meteoritos y las ondas producidas por la interacción del campo magnético terrestre con el viento solar.
Entre las múltiples causas investigadas, figura la que el Hum se limitaría a ondas producidas por la ionización del aire en torno a fuentes eléctricas de alta tensión cercanas a los poblados afectados.
James Nelly, profesor de la Universidad de Nuevo México, afirma que todas las personas afectadas por el sonido cuentan historias muy creíbles, las cuales demuestran que no son debido a perturbaciones mentales ni se asientan en falacias.
Este eco constituye un desafío para los científicos, que aún no encuentran una explicación racional a fin de describir el misterioso origen de estos zumbidos.
Por Silvio González*
*Jefe del Departamento de Difusión de Prensa Latina.
arb/sgl
Fuente: Prensa Latina
Denominado " Hum" en inglés, es básicamente el nombre genérico de un evento sonoro persistente e invasivo de baja frecuencia que no es escuchado por todas las personas ni puede ser evitado con audífonos, según afirma Robert Stask, de la revista Misterios sin resolver.
Todo comenzó en el poblado de Taos, en el estado de Nuevo México, y por eso muchos expertos lo llaman el "Zumbido de Taos", para poder registrarlo como un fenómeno que ya se experimenta en todos los continentes.
En Hawai, por ejemplo, el sonido es escuchado fundamentalmente por personas que lo describen como un motor de diesel acelerado; normalmente no se puede registrar con micrófonos, y su fuente y naturaleza son prácticamente imposibles de localizar.
Algunas personas escuchan el ruido dentro de sus hogares, pero no al aire libre y lo perciben como vibraciones en el cuerpo y no tanto en el tímpano, especialmente en horas de la noche; en tanto otras lo sienten continuamente y ciertos hombres y mujeres solamente en determinados momentos.
Varias reacciones a este evento pueden interferir seriamente con las actividades diarias y la salud humana, como son el insomnio, la ansiedad y otras alteraciones nerviosas, manifiesta el doctor Tom Moir, de la Universidad de Massey, en Nueva Zelanda.
HISTORIAL DEL EXTRAÑO SUCESO
Los primeros indicios del sonido aparecieron en la década de 1970 en Estados Unidos pero los expertos sólo los comenzaron a investigarlo con seriedad veinte años después, tras numerosas quejas de ciudadanos y autoridades locales.
Alrededor de esa misma fecha, otros individuos presentaron quejas similares en Nueva Zelanda y Reino Unido, pero nadie puede asegurar aún que se trata de un evento sonoro similar en los dos países.
En el caso del poblado de Kokomo, en el estado de Indiana, Estados Unidos, la existencia de grandes industrias pesadas hacen que los científicos consideren el ruido generado por dos grandes ventiladores de enfriamiento, ubicados en la fábrica de automóviles Chrysler, que emiten un elevado nivel sonoro.
El diario Albuquerque Journal publicó numerosos reportajes sobre este enigma donde se informa que muchos afectados lo relacionan con objetos voladores no identificados, con cuestiones de fantasmas, con trabajos de minería subterráneos secretos, con líneas de alto voltaje y con pruebas clandestinas de armamento nuclear a grandes profundidades.
Uno de los posibles orígenes del zumbido, apuntan otros investigadores, pudieran ser los procedimientos de comunicación de submarinos militares, tales como el ELF (Sistema de Frecuencias Extremadamente Bajas), que son capaces de atravesar la tierra y el mar en cualquier dirección.
Mientras, otra opción la representan los sistemas de calentamiento ionosféricas de muy alta frecuencia, llevados a cabo por Estados Unidos, Rusia y Noruega, tales como el denominado HAARP, desarrollado en Alaska desde 1993.
Hacia otro plano de las hipótesis, el "zumbido" podría ser provocado por factores naturales, como el movimiento de las placas terrestres, las ondas electromagnéticas causadas por meteoritos y las ondas producidas por la interacción del campo magnético terrestre con el viento solar.
Entre las múltiples causas investigadas, figura la que el Hum se limitaría a ondas producidas por la ionización del aire en torno a fuentes eléctricas de alta tensión cercanas a los poblados afectados.
James Nelly, profesor de la Universidad de Nuevo México, afirma que todas las personas afectadas por el sonido cuentan historias muy creíbles, las cuales demuestran que no son debido a perturbaciones mentales ni se asientan en falacias.
Este eco constituye un desafío para los científicos, que aún no encuentran una explicación racional a fin de describir el misterioso origen de estos zumbidos.
Por Silvio González*
*Jefe del Departamento de Difusión de Prensa Latina.
arb/sgl
Fuente: Prensa Latina
sábado, 19 de noviembre de 2011
Comentario
Javier Mujica / Concepción / CHILE ha dejado un nuevo comentario en su entrada "tinnitus, tratamiento con fármacos":
Realmente para las personas que soportamos esta desagradable molestia del TINNITUS encontrar un método o tratamiento para el mísmo es tener la esperanza en poder algún día mejorar nuestra deteriorada calidad de vida...Gracias
Vista de Laguna Chica San Pedro, Concepcion - CHILE
N de la R. Javier, Gracias por sus comentarios
Realmente para las personas que soportamos esta desagradable molestia del TINNITUS encontrar un método o tratamiento para el mísmo es tener la esperanza en poder algún día mejorar nuestra deteriorada calidad de vida...Gracias
N de la R. Javier, Gracias por sus comentarios
Effects of altered auditory feedback across effector systems: Production of melodies by keyboard and singing
Authors:
Peter Q. Pfordresher ; James T. Mantella
a University at Buffalo, State University of New York, United States
Available online 17 November 2011.
Abstract
We report an experiment that tested whether effects of altered auditory feedback (AAF) during piano performance differ from its effects during singing.
These effector systems differ with respect to the mapping between motor gestures and pitch content of auditory feedback.
Whereas this action-effect mapping is highly reliable during phonation in any vocal motor task (singing or speaking), mapping between finger movements and pitch occurs only in limited situations, such as piano playing.
Effects of AAF in both tasks replicated results previously found for keyboard performance (Pfordresher, 2003), in that asynchronous (delayed) feedback slowed timing whereas alterations to feedback pitch increased error rates, and the effect of asynchronous feedback was similar in magnitude across tasks.
However, manipulations of feedback pitch had larger effects on singing than on keyboard production, suggesting effector-specific differences in sensitivity to action-effect mapping with respect to feedback content.
These results support the view that disruption from AAF is based on abstract, effector independent, response–effect associations but that the strength of associations differs across effector systems.
Highlights
► Tested effects of altered auditory feedback (AAF) in piano performances and singing.
► Effects of AAF similar across domains for disruption of timing versus sequencing. ► However, singing was more vulnerable to disruption from alterations of pitch. ► Suggests effector-independent sensorimotor associations that vary in magnitude.
Fuente: Acta Psychologica
doi:10.1016/j.actpsy.2011.10.009
Peter Q. Pfordresher ; James T. Mantella
a University at Buffalo, State University of New York, United States
Available online 17 November 2011.
Abstract
We report an experiment that tested whether effects of altered auditory feedback (AAF) during piano performance differ from its effects during singing.
These effector systems differ with respect to the mapping between motor gestures and pitch content of auditory feedback.
Whereas this action-effect mapping is highly reliable during phonation in any vocal motor task (singing or speaking), mapping between finger movements and pitch occurs only in limited situations, such as piano playing.
Effects of AAF in both tasks replicated results previously found for keyboard performance (Pfordresher, 2003), in that asynchronous (delayed) feedback slowed timing whereas alterations to feedback pitch increased error rates, and the effect of asynchronous feedback was similar in magnitude across tasks.
However, manipulations of feedback pitch had larger effects on singing than on keyboard production, suggesting effector-specific differences in sensitivity to action-effect mapping with respect to feedback content.
These results support the view that disruption from AAF is based on abstract, effector independent, response–effect associations but that the strength of associations differs across effector systems.
Highlights
► Tested effects of altered auditory feedback (AAF) in piano performances and singing.
► Effects of AAF similar across domains for disruption of timing versus sequencing. ► However, singing was more vulnerable to disruption from alterations of pitch. ► Suggests effector-independent sensorimotor associations that vary in magnitude.
Fuente: Acta Psychologica
doi:10.1016/j.actpsy.2011.10.009
El lado oscuro de la neuroplasticidad
Autores: Arthur Autor Brown , Lynne C. Weavera
El lado oscuro de la neuroplasticidad, una lesión de laboratorio de la médula espinal,
Robarts Research Institute, Universidad de Western Ontario, London, Ontario N6A 5K8
Disponible en Internet el 12 de noviembre de 2011.
Neuroplasticidad
fuente de la imagen:2009 Surya. Contacto: e-mail: secretariadeldojo@yahoo.es Telf: + 34 639 187 140
Sea dramática o moderada, la recuperación de la función neurológica después de una lesión de la médula espinal (SCI) es en gran medida debida a la neuroplasticidad - el proceso por el cual el sistema nervioso responde a la lesión mediante el establecimiento de nuevas conexiones sinápticas o mediante la alteración de la fuerza de las sinapsis existentes.
Sin embargo, la neuroplasticidad mismo que permite recuperar la función locomotora también produce consecuencias negativas como dolor y disfunción de los órganos controlados por el sistema nervioso autónomo.
Esta revisión se centrará específicamente en la neuroplasticidad estructural (el crecimiento de nuevas conexiones sinápticas) después de la lesión y en el consiguiente desarrollo de dolor y disreflexia autonómica, una condición de hipertensión episódica.
La Neuroplasticidad después de la lesión es estimulada por la desaferentización de las neuronas espinales por debajo de la lesión y por la expresión de factores de crecimiento o neurotrofinas como el factor de crecimiento nervioso (NGF).
Una amplia gama de estrategias terapéuticas que afectan a la neuroplasticidad se están desarrollando para el tratamiento del SCI.
En un extremo del espectro están las estrategias terapéuticas que aumenten directa o indirectamente el NGF en la médula espinal lesionada, y los efectos más sólidos sobre la neuroplasticidad.
En el otro extremo del espectro están las estrategias neuroprotectoras centradas en el apoyo y el rescate de los axones lesionados o heridos parcialmente,los cuales podrían limitar el estímulo de neuroplasticidad de la desaferentación .
En medio de este espectro se encuentran las estrategias que bloquean los inhibidores de crecimiento axonal sin necesidad de un estímulo de crecimiento.
La literatura apoya la idea que las consecuencias negativas de la neuroplasticidad a desarrollar con mayor frecuencia con terapias que estimulan directamente el crecimiento del nervio se desarrollan en la médula espinal lesionada sin tratar.
En comparación con estas condiciones, la neuroplasticidad con resultados negativos es menos frecuente después de realizar tratamientos mediante inhibidores que neutralizan el crecimiento axonal, y por lo menos aparentemnte después de las estrategias que promueven la neuroprotección.
Fuente:Experimental Neurology
doi:10.1016/j.expneurol.2011.11.004
El lado oscuro de la neuroplasticidad, una lesión de laboratorio de la médula espinal,
Robarts Research Institute, Universidad de Western Ontario, London, Ontario N6A 5K8
Disponible en Internet el 12 de noviembre de 2011.
fuente de la imagen:2009 Surya. Contacto: e-mail: secretariadeldojo@yahoo.es Telf: + 34 639 187 140
Sea dramática o moderada, la recuperación de la función neurológica después de una lesión de la médula espinal (SCI) es en gran medida debida a la neuroplasticidad - el proceso por el cual el sistema nervioso responde a la lesión mediante el establecimiento de nuevas conexiones sinápticas o mediante la alteración de la fuerza de las sinapsis existentes.
Sin embargo, la neuroplasticidad mismo que permite recuperar la función locomotora también produce consecuencias negativas como dolor y disfunción de los órganos controlados por el sistema nervioso autónomo.
Esta revisión se centrará específicamente en la neuroplasticidad estructural (el crecimiento de nuevas conexiones sinápticas) después de la lesión y en el consiguiente desarrollo de dolor y disreflexia autonómica, una condición de hipertensión episódica.
La Neuroplasticidad después de la lesión es estimulada por la desaferentización de las neuronas espinales por debajo de la lesión y por la expresión de factores de crecimiento o neurotrofinas como el factor de crecimiento nervioso (NGF).
Una amplia gama de estrategias terapéuticas que afectan a la neuroplasticidad se están desarrollando para el tratamiento del SCI.
En un extremo del espectro están las estrategias terapéuticas que aumenten directa o indirectamente el NGF en la médula espinal lesionada, y los efectos más sólidos sobre la neuroplasticidad.
En el otro extremo del espectro están las estrategias neuroprotectoras centradas en el apoyo y el rescate de los axones lesionados o heridos parcialmente,los cuales podrían limitar el estímulo de neuroplasticidad de la desaferentación .
En medio de este espectro se encuentran las estrategias que bloquean los inhibidores de crecimiento axonal sin necesidad de un estímulo de crecimiento.
La literatura apoya la idea que las consecuencias negativas de la neuroplasticidad a desarrollar con mayor frecuencia con terapias que estimulan directamente el crecimiento del nervio se desarrollan en la médula espinal lesionada sin tratar.
En comparación con estas condiciones, la neuroplasticidad con resultados negativos es menos frecuente después de realizar tratamientos mediante inhibidores que neutralizan el crecimiento axonal, y por lo menos aparentemnte después de las estrategias que promueven la neuroprotección.
Fuente:Experimental Neurology
doi:10.1016/j.expneurol.2011.11.004
Filosofia en el foro de acúfenos de España
las diez mejores frases de filosofia:
"Pocos ven lo que somos, pero todos ven lo que aparentamos." Maquiavelo.
"Cuando una batalla está perdida, queda la retirada; sólo los que han huido pueden combatir en otra." Demóstenes.
"La filosofía es la ciencia que complica las cosas que todo el mundo sabe". Juan Benet.
"Felicidad no es hacer lo que uno quiere sino querer lo que uno hace." Jean Paul Sartre.
"No sabemos lo que nos pasa y eso es precisamente lo que nos pasa." Ortega y Gasset.
"El que domina a los otros es fuerte; el que se domina a sí mismo es poderoso." Lao-tsé.
"Sorprenderse, extrañarse, es comenzar a entender." Ortega y Gasset.
"Si abordas cada situación como asunto de vida o muerte, morirás muchas veces." Adam Smith.
"En general, las nueve décimas partes de nuestra felicidad se fundamentan en la salud." Arthur Schopenhauer"
El sabio puede cambiar de opinión. El necio, nunca." Immanuel Kant.
Fuente: http://www.acufenos.org/~foro/
"Pocos ven lo que somos, pero todos ven lo que aparentamos." Maquiavelo.
"Cuando una batalla está perdida, queda la retirada; sólo los que han huido pueden combatir en otra." Demóstenes.
"La filosofía es la ciencia que complica las cosas que todo el mundo sabe". Juan Benet.
"Felicidad no es hacer lo que uno quiere sino querer lo que uno hace." Jean Paul Sartre.
"No sabemos lo que nos pasa y eso es precisamente lo que nos pasa." Ortega y Gasset.
"El que domina a los otros es fuerte; el que se domina a sí mismo es poderoso." Lao-tsé.
"Sorprenderse, extrañarse, es comenzar a entender." Ortega y Gasset.
"Si abordas cada situación como asunto de vida o muerte, morirás muchas veces." Adam Smith.
"En general, las nueve décimas partes de nuestra felicidad se fundamentan en la salud." Arthur Schopenhauer"
El sabio puede cambiar de opinión. El necio, nunca." Immanuel Kant.
Fuente: http://www.acufenos.org/~foro/
Un fan de Them Crooked Vultures se suicida por sufrir tinnitus durante meses tras un concierto del grupo
Autor: James Ulrich 19/11/2011
Terrible noticia que nos llega desde el Reino Unido.
Robert McIndoe, un inglés de 52 años, se apuñaló hasta llegar a la muerte tras sufrir durante tres meses tinnitus, enfermedad que hace sentir un pitido continuo en los oídos proveniente del interior, y por lo cual no pudo dormir durante todo ese tiempo.
Este caso grave de tinnitus habría sido provocado tras asistir a un concierto del super-grupo Them Crooked Vultures, formado por Dave Grohl (frontman de Foo Fighters) a la batería, Josh Homme (líder de Queens of the Stone Age) a la voz y a la guitarra, y John Paul Jones (veterano de Led Zeppelin) al bajo.
Tras intentarlo todo para remediarlo y diagnósticos fallidos de los médicos, el hombre no pudo aguantar más y decidió poner fin a su vida, a pesar de tener mujer y dos hijos.
Them Crooked Vultures
Parece ser que en su día no le dio mucha importancia, ya que “puede ser algo normal” y le había ocurrido también a un amigo suyo en el mismo concierto, pero días después no tardó en maldecir el no haber usado tapones de los oídos, convirtiendo su vida en un completo infierno.
Ya nos podemos imaginar cómo pudo ser si llegó al punto de decidir querer morir…
Esto abre de nuevo el debate de si debería limitarse de alguna manera el volumen máximo de sonido que puede haber en un concierto o de la obligatoriedad de usar tapones de los oídos para amortiguar el posible efecto perjudicial.
Y esto no se aplica sólo al público de los conciertos, sino a los reproductores de música con cascos que todos tenemos y a los propios artistas.
Son numerosos los casos de músicos que sufren o sufrieron de esta enfermedad. Véanse como ejemplos James Hetfield, Lars Ulrich (ambos de Metallica), Neil Young, Pete Townshend (The Who), Barbra Streisand, Moby, Will.i.am., Ville Valo (HIM), Myles Kennedy, Joey Jordison (Slipknot), Eric Clapton, Bono (U2), Beethoven, o ya fuera del ámbito musical, personalidades como Goya, Charles Darwin o hasta el propio Adolf Hitler.
Vía: Blabbermouth y DailyMail
Fuente: Them Crooked Vultures: Página oficial
Nota de la Redacción: Referente al caso que describe la nota reproducida mas arriba, tenemos la impresion que la posibilidad de suicidio entre los pacientes con acúfenos es altamente infrecuente, y pensamos ocurre en personas con algun trastorno grave y previo de la personalidad, no hemos visto ningún caso de suicido entre alrededor de 4500 pacientes asistidos personalmente desde 1985 tanto en nuestra practica pública en el Hospital de Clinicas General San Martín de Buenos Aires, ni en nuestra actividad privada en el Centro de Acúfenos de Buenos Aires.
Dr. Dario Roitman.
Terrible noticia que nos llega desde el Reino Unido.
Robert McIndoe, un inglés de 52 años, se apuñaló hasta llegar a la muerte tras sufrir durante tres meses tinnitus, enfermedad que hace sentir un pitido continuo en los oídos proveniente del interior, y por lo cual no pudo dormir durante todo ese tiempo.
Este caso grave de tinnitus habría sido provocado tras asistir a un concierto del super-grupo Them Crooked Vultures, formado por Dave Grohl (frontman de Foo Fighters) a la batería, Josh Homme (líder de Queens of the Stone Age) a la voz y a la guitarra, y John Paul Jones (veterano de Led Zeppelin) al bajo.
Tras intentarlo todo para remediarlo y diagnósticos fallidos de los médicos, el hombre no pudo aguantar más y decidió poner fin a su vida, a pesar de tener mujer y dos hijos.
Parece ser que en su día no le dio mucha importancia, ya que “puede ser algo normal” y le había ocurrido también a un amigo suyo en el mismo concierto, pero días después no tardó en maldecir el no haber usado tapones de los oídos, convirtiendo su vida en un completo infierno.
Ya nos podemos imaginar cómo pudo ser si llegó al punto de decidir querer morir…
Esto abre de nuevo el debate de si debería limitarse de alguna manera el volumen máximo de sonido que puede haber en un concierto o de la obligatoriedad de usar tapones de los oídos para amortiguar el posible efecto perjudicial.
Y esto no se aplica sólo al público de los conciertos, sino a los reproductores de música con cascos que todos tenemos y a los propios artistas.
Son numerosos los casos de músicos que sufren o sufrieron de esta enfermedad. Véanse como ejemplos James Hetfield, Lars Ulrich (ambos de Metallica), Neil Young, Pete Townshend (The Who), Barbra Streisand, Moby, Will.i.am., Ville Valo (HIM), Myles Kennedy, Joey Jordison (Slipknot), Eric Clapton, Bono (U2), Beethoven, o ya fuera del ámbito musical, personalidades como Goya, Charles Darwin o hasta el propio Adolf Hitler.
Vía: Blabbermouth y DailyMail
Fuente: Them Crooked Vultures: Página oficial
Nota de la Redacción: Referente al caso que describe la nota reproducida mas arriba, tenemos la impresion que la posibilidad de suicidio entre los pacientes con acúfenos es altamente infrecuente, y pensamos ocurre en personas con algun trastorno grave y previo de la personalidad, no hemos visto ningún caso de suicido entre alrededor de 4500 pacientes asistidos personalmente desde 1985 tanto en nuestra practica pública en el Hospital de Clinicas General San Martín de Buenos Aires, ni en nuestra actividad privada en el Centro de Acúfenos de Buenos Aires.
Dr. Dario Roitman.
jueves, 17 de noviembre de 2011
Meal anticipation potentiates postprandial ghrelin suppression in humans
Volker Otta, Monique Friedricha, Janna Zemlina, Hendrik Lehnertb, Bernd Schultesc, Jan Bornd, Manfred Hallschmida
Purchase
a Department of Neuroendocrinology, Hs. 50.1, University of Luebeck, Ratzeburger Allee 160, 23538 Luebeck, Germany
b Department of Internal Medicine I, University of Luebeck, Luebeck, Germany
c Department of Interdisciplinary Obesity Center, Kantonsspital St. Gallen, Rorschach, Switzerland
d Department of Medical Psychology and Behavioral Neurobiology, University of Tuebingen, Tuebingen, Germany
Available online 16 November 2011.
Summary
Circulating concentrations of the orexigenic hormone ghrelin show a postprandial decrease in dependence on meal size and composition.
Cognitive determinants of postprandial ghrelin suppression in humans are largely unexplored.
We assessed the effects of cued meal anticipation on pre- and postprandial concentrations of total plasma ghrelin, pancreatic polypeptide and leptin as well as on markers of glucose metabolism in healthy men.
In a between-subject comparison, meal anticipation was induced in 14 fasted men at 08:00 h by the announcement and subsequent presentation of a breakfast buffet.
Fifteen fasted control subjects were informed that they would remain fasted until noon.
At 10:00 h, both groups were served a rich free-choice breakfast. At 12:00 h, all subjects underwent a snack test assessing casual cookie intake.
Circulating concentrations of ghrelin, pancreatic polypeptide, glucose, insulin and leptin were frequently assessed.
Preprandial endocrine parameters as well as breakfast intake (all p > 0.23) and subsequent snack consumption (p > 0.83) were comparable between groups.
The postprandial suppression of ghrelin levels observed in both groups was markedly stronger in subjects who had anticipated breakfast intake (p < 0.03) while pancreatic polypeptide concentrations did not differ between groups (p > 0.56).
Results indicate that meal anticipation is a critical determinant of postprandial ghrelin suppression that, as suggested by unaltered pancreatic polypeptide levels, appears to be mediated independent of vagal activation.
Our findings highlight the role of subtle cognitive factors in the postprandial regulation of ghrelin secretion, suggesting that neurobehavioral approaches to improved food intake control should take into account meal anticipatory mechanisms.
Keywords: Food intake; Food anticipation; Ghrelin; Postprandial; Central nervous system; Pancreatic polypeptide
Fuente: Psychoneuroendocrinology
doi:10.1016/j.psyneuen.2011.10.007
Purchase
a Department of Neuroendocrinology, Hs. 50.1, University of Luebeck, Ratzeburger Allee 160, 23538 Luebeck, Germany
b Department of Internal Medicine I, University of Luebeck, Luebeck, Germany
c Department of Interdisciplinary Obesity Center, Kantonsspital St. Gallen, Rorschach, Switzerland
d Department of Medical Psychology and Behavioral Neurobiology, University of Tuebingen, Tuebingen, Germany
Available online 16 November 2011.
Summary
Circulating concentrations of the orexigenic hormone ghrelin show a postprandial decrease in dependence on meal size and composition.
Cognitive determinants of postprandial ghrelin suppression in humans are largely unexplored.
We assessed the effects of cued meal anticipation on pre- and postprandial concentrations of total plasma ghrelin, pancreatic polypeptide and leptin as well as on markers of glucose metabolism in healthy men.
In a between-subject comparison, meal anticipation was induced in 14 fasted men at 08:00 h by the announcement and subsequent presentation of a breakfast buffet.
Fifteen fasted control subjects were informed that they would remain fasted until noon.
At 10:00 h, both groups were served a rich free-choice breakfast. At 12:00 h, all subjects underwent a snack test assessing casual cookie intake.
Circulating concentrations of ghrelin, pancreatic polypeptide, glucose, insulin and leptin were frequently assessed.
Preprandial endocrine parameters as well as breakfast intake (all p > 0.23) and subsequent snack consumption (p > 0.83) were comparable between groups.
The postprandial suppression of ghrelin levels observed in both groups was markedly stronger in subjects who had anticipated breakfast intake (p < 0.03) while pancreatic polypeptide concentrations did not differ between groups (p > 0.56).
Results indicate that meal anticipation is a critical determinant of postprandial ghrelin suppression that, as suggested by unaltered pancreatic polypeptide levels, appears to be mediated independent of vagal activation.
Our findings highlight the role of subtle cognitive factors in the postprandial regulation of ghrelin secretion, suggesting that neurobehavioral approaches to improved food intake control should take into account meal anticipatory mechanisms.
Keywords: Food intake; Food anticipation; Ghrelin; Postprandial; Central nervous system; Pancreatic polypeptide
Fuente: Psychoneuroendocrinology
doi:10.1016/j.psyneuen.2011.10.007
New research suggests possible new treatments for glue ear
Otitis media with effusion, commonly known as glue ear, affects as many as 8 out of 10 children before the age of 10.
If a child has glue ear for a long time it can affect their speech and language development, they can fall behind at school and, without the right support, they may even suffer behavioural problems.
A research paper just published in PLoS Genetics has identified new factors involved in the formation of glue ear.
It suggests that some existing drugs, currently used for cancer treatment, may offer non-surgical, non-invasive alternatives to the current treatment option of grommet surgery. Around 30,000 grommet insertions are carried out each year in the UK.
Professor Steve Brown, Director of the Medical Research Council’s Mammalian Genetics Unit, who is an adviser to Deafness Research UK and the lead researcher in the study, said that a lack of oxygen reaching the middle ear was a key factor in the development of the condition.
Fuente:Soundbite November 2011
If a child has glue ear for a long time it can affect their speech and language development, they can fall behind at school and, without the right support, they may even suffer behavioural problems.
A research paper just published in PLoS Genetics has identified new factors involved in the formation of glue ear.
It suggests that some existing drugs, currently used for cancer treatment, may offer non-surgical, non-invasive alternatives to the current treatment option of grommet surgery. Around 30,000 grommet insertions are carried out each year in the UK.
Professor Steve Brown, Director of the Medical Research Council’s Mammalian Genetics Unit, who is an adviser to Deafness Research UK and the lead researcher in the study, said that a lack of oxygen reaching the middle ear was a key factor in the development of the condition.
Fuente:Soundbite November 2011
Tinnitus meeting showcases new research
We had a valuable opportunity to promote the work of the Deafness Research UK Advisory Service as well as updating our knowledge of the latest tinnitus research at a recent British Society of Audiology meeting.
Held at the UCL Ear Institute in London, the meeting began with delegates - mainly audiologists, clinicians and researchers – being given the chance to mingle and find out more about our leaflets and factsheets on tinnitus and related conditions. Leading researchers in the field followed with four presentations on understanding the mechanisms of tinnitus.
They looked at tinnitus pitch and audiometric variables, access pathways for tinnitus patients and paediatric and adult case studies.
Information presented at the meeting will be incorporated into the next edition of Deafness Research UK’s tinnitus research update leaflet.
For more information contact Email Research
Fuente: Soundbite November 2011
Held at the UCL Ear Institute in London, the meeting began with delegates - mainly audiologists, clinicians and researchers – being given the chance to mingle and find out more about our leaflets and factsheets on tinnitus and related conditions. Leading researchers in the field followed with four presentations on understanding the mechanisms of tinnitus.
They looked at tinnitus pitch and audiometric variables, access pathways for tinnitus patients and paediatric and adult case studies.
Information presented at the meeting will be incorporated into the next edition of Deafness Research UK’s tinnitus research update leaflet.
For more information contact Email Research
Fuente: Soundbite November 2011
Terapia para los acúfenos en Medica 2011
Terapia para los acúfenos en Medica 2011
La feria Medica 2011 trae todas las novedades en terapias y control de la salud.
El tratamiento de los acúfenos o tinnitus, que acosa, según estudios, a uno de cada diez adultos, es uno de los hitos de la feria.
El tinnitus se caracteriza por golpes, zumbidos o tonos agudos que son percibidos por el oído y que pueden llegar a ser muy molestos.
Ahora, un aparato del tamaño de una cajilla de fósforos podría ser la solución para liberarse de esos sonidos.
Esta novedad terapéutica fue galardonada con el “Premio alemán a la Innovación” y es una de las estrellas de las nuevas tecnologías médicas en la feria Medica 2011.
Se trata de un neuroestimulador que los pacientes deben utilizar durante cuatro horas por día.
El aparato –que cuesta unos 2.700 euros- emite estímulos al oído interno, gracias a lo cual el cerebro desaprende la percepción de esos tonos.
Hasta ahora, cerca de un 75 por ciento de los pacientes tratados con dichos aparatos respondieron positivamente al tratamiento, que dura de 6 a 12 meses, señaló Claus Martini, director de la compañía ANM, de Troisdorf, que los fabrica. Sin embargo, un 20 a un 30 por ciento de las personas tratadas no respondió al neuroestimulador.
Autora: CP/ dpa
Editor: José Ospina
Fuente: http://www.dw-world.de/dw/article/0,,15535952,00.html
Comentarios:
ANM Tinnitus Neurostimulator - hopeful news
(09/20/09 3:54 AM)
So I've recently read an account about a participant in the German clinical study with the ANM Neurostimulator (the acoustic stimulator by the Jülich Research Centre, which is kind of like a special mp3-player, so no implant or drug!).
This device creates a special tone adjusted to each person's individual tinnitus. We already had a thread about it, which you can find here.
This is an account by a participant called "Ding" (that's her nickname on a German tinnitus board).
Ding has got tinnitus for 13 years already, caused by an acute acoustic trauma which she got in a car accident (airbag). Last june she also had sudden hearing loss. She can hear the tinnitus al the time and it wakes her up at night.
Her tinnitus rages in the high frequencies and is about 30dB.
She also suffers from hyperacusis in her right ear. However she isn't dizzy or anything like that (no Menières disease). She has never partaken in any clincal study or experimental treatment before and didn't use any special masking device. Her hearing was fine as well besides the sudding hearing loss which occured in June.
When she had that herdoctor said she could take part in the Neurostimulator study, which she did.
Ding's tinnitus loudness varies from time to time, but that's not a problem for this study. A non-tonal tinnitus can cause problems, because you have got to set the tone of the device yourself.
If you don't do this correctly the tones played from the device can be considered uncomfortable or 'false'. She felt like this in her right ear (I guess her tinnitus fluctuates a bit there, but I'm not sure, my German isn't top notch).
She has worn the device for 6 hours a day.
This doesn't have to be one long sitting, but if you use it you've gotta wear it at least 1 hour straight. Whilst wearing the device you can continue your usual daily business (reading, talking, etc.), the only obstruction Ding experienced was that she couldn't use the telephone.
Immediately after usage she noticed that the tinnitus in her left ear changed. After four days she already realized it was improving.
Her right ear improved as well, but a bit less than her lef ear. In the early stage of the study the tones appeared to become less intrusive, but it was still there and at pretty much the same dB-level (for her feeling).
After three months she had to stop the treatment (this was around 10 days ago). The tinnitus in her left ear went away altogether (she stated "away like in really away")!
She still suffers from tinnitus in her right ear but it improved a lot as well. She has hopes that a continuation of the usage of the Neurostimulator will make it even better there as well (but the study has ended so at the moment she can't do that).
Also her hearing improved at lot in her tinnitus frequences (from 10 up to 30dB!). Of course dead hearing cells can't be regenerated this way, but tinnitus can influence hearing if it's loud.
Conclusion; this device sounds very promising.
However this is just one personal account and we have to wait until the full study results are published (which will happen this year).
And it won't work for everyone, considering the nature of tinnitus (it seems to be working for noise-induced tinnitus, but perhaps it won't work for people with stress-induced tinnitus for example, we just don't know yet). But it's a very hopeful nonetheless, seeing that this particular person had tinnitus for 13 years already and it made it go away fully in one ear (and perhaps more stimulation of the right ear and adjustment/refinement of the device can make it go away there as well). I'll keep you guys posted if I hear anything new about it!
P.S. Excuse me if my English is a bit clunky at times, I had to translate this from a German board and I'm not a native English nor German speaker ;)
P.S.2. Ding states the study continues for about three weeks from now on until it is closed for all participants. The results should be published afterwards, my guess is anything from late October until December.
La feria Medica 2011 trae todas las novedades en terapias y control de la salud.
El tratamiento de los acúfenos o tinnitus, que acosa, según estudios, a uno de cada diez adultos, es uno de los hitos de la feria.
El tinnitus se caracteriza por golpes, zumbidos o tonos agudos que son percibidos por el oído y que pueden llegar a ser muy molestos.
Ahora, un aparato del tamaño de una cajilla de fósforos podría ser la solución para liberarse de esos sonidos.
Esta novedad terapéutica fue galardonada con el “Premio alemán a la Innovación” y es una de las estrellas de las nuevas tecnologías médicas en la feria Medica 2011.
Se trata de un neuroestimulador que los pacientes deben utilizar durante cuatro horas por día.
El aparato –que cuesta unos 2.700 euros- emite estímulos al oído interno, gracias a lo cual el cerebro desaprende la percepción de esos tonos.
Hasta ahora, cerca de un 75 por ciento de los pacientes tratados con dichos aparatos respondieron positivamente al tratamiento, que dura de 6 a 12 meses, señaló Claus Martini, director de la compañía ANM, de Troisdorf, que los fabrica. Sin embargo, un 20 a un 30 por ciento de las personas tratadas no respondió al neuroestimulador.
Autora: CP/ dpa
Editor: José Ospina
Fuente: http://www.dw-world.de/dw/article/0,,15535952,00.html
Comentarios:
ANM Tinnitus Neurostimulator - hopeful news
(09/20/09 3:54 AM)
So I've recently read an account about a participant in the German clinical study with the ANM Neurostimulator (the acoustic stimulator by the Jülich Research Centre, which is kind of like a special mp3-player, so no implant or drug!).
This device creates a special tone adjusted to each person's individual tinnitus. We already had a thread about it, which you can find here.
This is an account by a participant called "Ding" (that's her nickname on a German tinnitus board).
Ding has got tinnitus for 13 years already, caused by an acute acoustic trauma which she got in a car accident (airbag). Last june she also had sudden hearing loss. She can hear the tinnitus al the time and it wakes her up at night.
Her tinnitus rages in the high frequencies and is about 30dB.
She also suffers from hyperacusis in her right ear. However she isn't dizzy or anything like that (no Menières disease). She has never partaken in any clincal study or experimental treatment before and didn't use any special masking device. Her hearing was fine as well besides the sudding hearing loss which occured in June.
When she had that herdoctor said she could take part in the Neurostimulator study, which she did.
Ding's tinnitus loudness varies from time to time, but that's not a problem for this study. A non-tonal tinnitus can cause problems, because you have got to set the tone of the device yourself.
If you don't do this correctly the tones played from the device can be considered uncomfortable or 'false'. She felt like this in her right ear (I guess her tinnitus fluctuates a bit there, but I'm not sure, my German isn't top notch).
She has worn the device for 6 hours a day.
This doesn't have to be one long sitting, but if you use it you've gotta wear it at least 1 hour straight. Whilst wearing the device you can continue your usual daily business (reading, talking, etc.), the only obstruction Ding experienced was that she couldn't use the telephone.
Immediately after usage she noticed that the tinnitus in her left ear changed. After four days she already realized it was improving.
Her right ear improved as well, but a bit less than her lef ear. In the early stage of the study the tones appeared to become less intrusive, but it was still there and at pretty much the same dB-level (for her feeling).
After three months she had to stop the treatment (this was around 10 days ago). The tinnitus in her left ear went away altogether (she stated "away like in really away")!
She still suffers from tinnitus in her right ear but it improved a lot as well. She has hopes that a continuation of the usage of the Neurostimulator will make it even better there as well (but the study has ended so at the moment she can't do that).
Also her hearing improved at lot in her tinnitus frequences (from 10 up to 30dB!). Of course dead hearing cells can't be regenerated this way, but tinnitus can influence hearing if it's loud.
Conclusion; this device sounds very promising.
However this is just one personal account and we have to wait until the full study results are published (which will happen this year).
And it won't work for everyone, considering the nature of tinnitus (it seems to be working for noise-induced tinnitus, but perhaps it won't work for people with stress-induced tinnitus for example, we just don't know yet). But it's a very hopeful nonetheless, seeing that this particular person had tinnitus for 13 years already and it made it go away fully in one ear (and perhaps more stimulation of the right ear and adjustment/refinement of the device can make it go away there as well). I'll keep you guys posted if I hear anything new about it!
P.S. Excuse me if my English is a bit clunky at times, I had to translate this from a German board and I'm not a native English nor German speaker ;)
P.S.2. Ding states the study continues for about three weeks from now on until it is closed for all participants. The results should be published afterwards, my guess is anything from late October until December.
Sub-chronic dietary tryptophan depletion – An animal model of depression with improved face and good construct validity
M. Franklina, I. Bermudeza, H. Murckc, d, 1, N. Singewaldb, S. Gaburrob, 2
Purchase
a School of Life Sciences, Oxford Brookes University, Oxford OX3 0BP, UK
b Department of Pharmacology and Toxicology, Institute of Pharmacy and Centre for Molecular Biosciences, Innsbruck, University of Innsbruck, Innsbruck, Austria
c Bristol-Myers Squibb, Pennington, NJ, USA
d Clinic of Psychiatry and Psychotherapy, Philipps-University of Marburg, Germany
Abstract
Sub-chronic tryptophan depletion (SCTD) is proposed as an animal model for depression.
Aims were to test the hypothesis and optimise the time of SCTD-induced depression-related behaviour and associated biochemical changes.
Sprague Dawley rats were treated with a low tryptophan (TRP) containing diet for 0, 7 or 14 days.
Peripheral and central neurochemical markers were measured. SCTD-induced depression-related behaviour was assessed by the forced swim test (FST).
Model sensitivity to antidepressants was tested by concomitant treatment with paroxetine.
SCTD-induced significant reductions in weight gain and measures of peripheral and central TRP.
Corticosterone, aldosterone and kynurenine (K), increased whilst kynurenic acid (KA), an NMDA antagonist decreased.
5-HT2 receptor binding Bmax was enhanced but was reversed by paroxetine.
Corticosterone and aldosterone were significantly negatively-correlated to weight gain.
SCTD increased floating time and reduced swimming time in the FST but were reversed by paroxetine.
Aldosterone was increased at 7 and 14 days, whereas other changes maximised at 14 days.
Aldosterone may be an early marker or causal link for depression development. Increased corticosterone and brain tissue 5-HT-receptor density may be correlates of depressive behaviour.
Consequential increases in NMDA signalling through increased K/KA ratios suggest the model may be useful for testing novel antidepressants.
Keywords: Tryptophan depletion; Serotonin; Behaviour; Corticosterone; Aldosterone; Kynurenine
fuente: Journal of Psychiatric Research
doi:10.1016/j.jpsychires.2011.10.003
Purchase
a School of Life Sciences, Oxford Brookes University, Oxford OX3 0BP, UK
b Department of Pharmacology and Toxicology, Institute of Pharmacy and Centre for Molecular Biosciences, Innsbruck, University of Innsbruck, Innsbruck, Austria
c Bristol-Myers Squibb, Pennington, NJ, USA
d Clinic of Psychiatry and Psychotherapy, Philipps-University of Marburg, Germany
Abstract
Sub-chronic tryptophan depletion (SCTD) is proposed as an animal model for depression.
Aims were to test the hypothesis and optimise the time of SCTD-induced depression-related behaviour and associated biochemical changes.
Sprague Dawley rats were treated with a low tryptophan (TRP) containing diet for 0, 7 or 14 days.
Peripheral and central neurochemical markers were measured. SCTD-induced depression-related behaviour was assessed by the forced swim test (FST).
Model sensitivity to antidepressants was tested by concomitant treatment with paroxetine.
SCTD-induced significant reductions in weight gain and measures of peripheral and central TRP.
Corticosterone, aldosterone and kynurenine (K), increased whilst kynurenic acid (KA), an NMDA antagonist decreased.
5-HT2 receptor binding Bmax was enhanced but was reversed by paroxetine.
Corticosterone and aldosterone were significantly negatively-correlated to weight gain.
SCTD increased floating time and reduced swimming time in the FST but were reversed by paroxetine.
Aldosterone was increased at 7 and 14 days, whereas other changes maximised at 14 days.
Aldosterone may be an early marker or causal link for depression development. Increased corticosterone and brain tissue 5-HT-receptor density may be correlates of depressive behaviour.
Consequential increases in NMDA signalling through increased K/KA ratios suggest the model may be useful for testing novel antidepressants.
Keywords: Tryptophan depletion; Serotonin; Behaviour; Corticosterone; Aldosterone; Kynurenine
fuente: Journal of Psychiatric Research
doi:10.1016/j.jpsychires.2011.10.003
Acúfenos: seccion acúfenos en las Artes: el cine, David Arratibel se fija en las vidas que pitan
Autor: ION STEGMEIER, PAMPLONA .
La película ya ha rodado la mayor parte de las vidas y faltan algunas secuencias que estarán concluidas para junio
Pello Gutiérrez registrando sonidos ante Arraibel. Oírse es un filme con el sonido como protagonista. FILMOTIVE.
Tres personas. Edades, profesiones y lugares de origen y residencia diferentes.
Uno: Albaro Arizaleta, batería y cantante del grupo de rock pamplonés El columpio asesino.
Dos: Gotzone Redondo, deportista, trabajadora de la Universidad del País Vasco en Vitoria y escritora de cuentos infantiles.
Y tres: Elena González, en paro, desde su ventana en Zierbena a un lado ve la playa y al otro las apocalípticas torres de Petronor.
La pregunta es:¿Qué tienen en común? Buscar pistas es en vano, es imposible averiguarlo, ni siquiera con un año de espionaje a cada uno de ellos. Habría que entrar en sus cerebros, porque los tres escuchan un pitido en sus cabezas. Sin cesar. Los llamados acúfenos, o tinnitus.
David Arratibel Aramburo sería la cuarta persona de esta historia. Él también escucha un pitido desde hace 15 años.
A la izquierda, David Arratibel Aramburo. DN.
Y está haciendo un documental, titulado Oírse, en los que entrelaza los tres casos anteriores.
Ya ha rodado el seguimiento cotidiano de esas tres vidas, también ha grabado en la sala anecoica (sin eco) de la empresa navarra Acústica Arquitectónica.
Faltan las secuencias en las que él, sin aparecer en plano, irá narrando su mirada subjetiva con la voz en off, hay que hacer además las secuencias en las que los protagonistas se someten a una audiometría, y los exteriores, para los que hace falta que nieve.
Arratibel, de 38 años, socio fundador de la agencia ACE Comunicación en Pamplona, se define "devoto" del Festival Punto de Vista.
Es de los que se coge toda la semana de fiesta y se traga lo que le echen. "Al final ves mucho documental de autor y en muchos de ellos el tema es lo de menos, sino que trasciende la historia y acaban saliendo cosas muy interesantes", explica.
Así que pensó que él, que desde hace tiempo tenía el tema de los acúfenos rondándole la cabeza -además, literalmente-, iba a intentar hacer un documental. Para ello recibió una subvención de la Fundación INAAC de 10.000 euros.
Oírse no tiene intención divulgativa, ni científica, ni es una historia de superación personal.
Simplemente es la historia de cuatro personas (él también) a las que les pita el oido. "El pitido es casi una excusa para hablar de la voz interior de las personas", explica su autor. "Suena un pitido dentro de ti, pero de repente a cualquier persona lo que le puede sonar es él mismo cuestionándose a sí mismo.Va por lo que tiene de viaje interior, cuando de repente algo dentro de ti empieza a sonar", apunta.
En ocasiones, los acúfenos pueden ser una tragedia.
De todo hay. "Cuando empieza, la gente se vuelve loca.
A todos nos ha pasado. Hay un momento en el que de repente te empieza a sonar el oído, al día siguiente también... y, bueno, te angustia un montón, y cuando te dicen "esto, lo más probable es que te dure toda la vida"... Hay gente que se ha cortado los dos nervios auditivos y les sigue sonando. Es una especie de misterio. Y hay gente que se ha matado, directamente", comenta.
La película tiene una frase que trata de resumirla: "empiezas a oírte y todo se vuelve frágil". "La fragilidad de ese momento -explica Arratibel- en el que algo no funciona en ti y escuchas algo que los demás no escuchan, con lo que tiene casi de locura".
Arratibel no quería dramas, ni historias de sufrimientos. "A mí me interesaba que la gente me contara cómo le sonaba el interior al margen del pitido", explica.
Además, el filme incluirá entrevistas al doctor José Ramón Mozota, presidente de la Sociedad Navarra de Otorrinolaringología, y a Iván Oliveros Sesha, filósofo reconocido en los campos de la meditación trascendental y las antiguas filosofías orientales.
Últimos trabajos
El sonido es un personaje más. Y el pitido, en concreto, el nexo de unión entre ellos. Arratibel ya conocía a Albaro Arizaleta, es amigo suyo.
Con las otras dos personas ha entablado relación a través de un proceso de selección a través de la Asociación Nacional de Afectados de Acúfenos.
Aunque los pitidos no son iguales. Oírse reproducirá los sonidos de cada uno.
Para este proyecto, Arratibel se ha rodeado de gente con trabajos muy premiados. Juan Sánchez Cuti será el responsable del diseño de sonido.
Ya lo hizo en dos documentales de Carles Bosch, Bicicleta, cuchara, manzana (Goya al mejor documental por esta relato del Alzheimer de Pasqual Maragall) y Balseros (nominado al Oscar sobre la vida de exiliados cubanos en Estados Unidos).
David Aguilar, director de Nao Yik, será el director de fotografía e Iñaki Sagastume (coordinador de producción de Balseros), el productor. Sagastume es de Pamplona pero fundó en Bilbao su productora, Filmotive, que produce la cinta.
Antes del 31 de junio tiene que estar terminada la película, pero Arratibel espera que esté hecha en marzo. Y proyectarla en el Punto de Vista de 2013.
"OÍRSE"
Director de fotografía: David Aguilar.
Sonido directo: Pello Gutiérrez.
Música original: El columpio asesino.
Diseño de sonido: Juan Sánchez, "Cuti".
Montaje: Pello Gutiérrez.
Ayudante de dirección: David Aguilar.
Director: David Arratibel.
Productor: Iñaki Sagastume.
Una producción de: Filmotive y David Arratibel. Con la colaboración del INAAC (Instituto Navarro de las Artes Audiovisuales y del Cine).
Fuente de la informacion: http://www.diariodenavarra.es/noticias/mas_actualidad/cultura/david_arratibel_fija_las_vidas_que_pitan_51753_1034.html
La película ya ha rodado la mayor parte de las vidas y faltan algunas secuencias que estarán concluidas para junio
Tres personas. Edades, profesiones y lugares de origen y residencia diferentes.
Uno: Albaro Arizaleta, batería y cantante del grupo de rock pamplonés El columpio asesino.
Dos: Gotzone Redondo, deportista, trabajadora de la Universidad del País Vasco en Vitoria y escritora de cuentos infantiles.
Y tres: Elena González, en paro, desde su ventana en Zierbena a un lado ve la playa y al otro las apocalípticas torres de Petronor.
La pregunta es:¿Qué tienen en común? Buscar pistas es en vano, es imposible averiguarlo, ni siquiera con un año de espionaje a cada uno de ellos. Habría que entrar en sus cerebros, porque los tres escuchan un pitido en sus cabezas. Sin cesar. Los llamados acúfenos, o tinnitus.
David Arratibel Aramburo sería la cuarta persona de esta historia. Él también escucha un pitido desde hace 15 años.
Y está haciendo un documental, titulado Oírse, en los que entrelaza los tres casos anteriores.
Ya ha rodado el seguimiento cotidiano de esas tres vidas, también ha grabado en la sala anecoica (sin eco) de la empresa navarra Acústica Arquitectónica.
Faltan las secuencias en las que él, sin aparecer en plano, irá narrando su mirada subjetiva con la voz en off, hay que hacer además las secuencias en las que los protagonistas se someten a una audiometría, y los exteriores, para los que hace falta que nieve.
Arratibel, de 38 años, socio fundador de la agencia ACE Comunicación en Pamplona, se define "devoto" del Festival Punto de Vista.
Es de los que se coge toda la semana de fiesta y se traga lo que le echen. "Al final ves mucho documental de autor y en muchos de ellos el tema es lo de menos, sino que trasciende la historia y acaban saliendo cosas muy interesantes", explica.
Así que pensó que él, que desde hace tiempo tenía el tema de los acúfenos rondándole la cabeza -además, literalmente-, iba a intentar hacer un documental. Para ello recibió una subvención de la Fundación INAAC de 10.000 euros.
Oírse no tiene intención divulgativa, ni científica, ni es una historia de superación personal.
Simplemente es la historia de cuatro personas (él también) a las que les pita el oido. "El pitido es casi una excusa para hablar de la voz interior de las personas", explica su autor. "Suena un pitido dentro de ti, pero de repente a cualquier persona lo que le puede sonar es él mismo cuestionándose a sí mismo.Va por lo que tiene de viaje interior, cuando de repente algo dentro de ti empieza a sonar", apunta.
En ocasiones, los acúfenos pueden ser una tragedia.
De todo hay. "Cuando empieza, la gente se vuelve loca.
A todos nos ha pasado. Hay un momento en el que de repente te empieza a sonar el oído, al día siguiente también... y, bueno, te angustia un montón, y cuando te dicen "esto, lo más probable es que te dure toda la vida"... Hay gente que se ha cortado los dos nervios auditivos y les sigue sonando. Es una especie de misterio. Y hay gente que se ha matado, directamente", comenta.
La película tiene una frase que trata de resumirla: "empiezas a oírte y todo se vuelve frágil". "La fragilidad de ese momento -explica Arratibel- en el que algo no funciona en ti y escuchas algo que los demás no escuchan, con lo que tiene casi de locura".
Arratibel no quería dramas, ni historias de sufrimientos. "A mí me interesaba que la gente me contara cómo le sonaba el interior al margen del pitido", explica.
Además, el filme incluirá entrevistas al doctor José Ramón Mozota, presidente de la Sociedad Navarra de Otorrinolaringología, y a Iván Oliveros Sesha, filósofo reconocido en los campos de la meditación trascendental y las antiguas filosofías orientales.
Últimos trabajos
El sonido es un personaje más. Y el pitido, en concreto, el nexo de unión entre ellos. Arratibel ya conocía a Albaro Arizaleta, es amigo suyo.
Con las otras dos personas ha entablado relación a través de un proceso de selección a través de la Asociación Nacional de Afectados de Acúfenos.
Aunque los pitidos no son iguales. Oírse reproducirá los sonidos de cada uno.
Para este proyecto, Arratibel se ha rodeado de gente con trabajos muy premiados. Juan Sánchez Cuti será el responsable del diseño de sonido.
Ya lo hizo en dos documentales de Carles Bosch, Bicicleta, cuchara, manzana (Goya al mejor documental por esta relato del Alzheimer de Pasqual Maragall) y Balseros (nominado al Oscar sobre la vida de exiliados cubanos en Estados Unidos).
David Aguilar, director de Nao Yik, será el director de fotografía e Iñaki Sagastume (coordinador de producción de Balseros), el productor. Sagastume es de Pamplona pero fundó en Bilbao su productora, Filmotive, que produce la cinta.
Antes del 31 de junio tiene que estar terminada la película, pero Arratibel espera que esté hecha en marzo. Y proyectarla en el Punto de Vista de 2013.
"OÍRSE"
Director de fotografía: David Aguilar.
Sonido directo: Pello Gutiérrez.
Música original: El columpio asesino.
Diseño de sonido: Juan Sánchez, "Cuti".
Montaje: Pello Gutiérrez.
Ayudante de dirección: David Aguilar.
Director: David Arratibel.
Productor: Iñaki Sagastume.
Una producción de: Filmotive y David Arratibel. Con la colaboración del INAAC (Instituto Navarro de las Artes Audiovisuales y del Cine).
Fuente de la informacion: http://www.diariodenavarra.es/noticias/mas_actualidad/cultura/david_arratibel_fija_las_vidas_que_pitan_51753_1034.html
A pilot study of the effects of cannabis on appetite hormones in HIV-infected adult men
Research Report
Patricia K. Riggsa, Florin Vaidaa, Steven S. Rossib, Linda S. Sorkinc, Ben Gouauxa, Igor Granta, Ronald J. Ellisa
a HIV Neurobehavioral Research Center (HNRC), University of California, San Diego, USA
b Department of Pediatrics, University of California, San Diego, USA
c Department of Anesthesiology, University of California, San Diego, USA
Received 28 July 2011; revised 18 October 2011; Accepted 2 November 2011. Available online 7 November 2011.
Abstract
Rationale
The endocannabinoid system is under active investigation as a pharmacological target for obesity management due to its role in appetite regulation and metabolism.
Exogenous cannabinoids such as tetrahydrocannabinol (THC) stimulate appetite and food intake.
However, there are no controlled observations directly linking THC to changes of most of the appetite hormones.
Objectives
We took the opportunity afforded by a placebo-controlled trial of smoked medicinal cannabis for HIV-associated neuropathic pain to evaluate the effects of THC on the appetite hormones ghrelin, leptin and PYY, as well as on insulin.
Methods
In this double-blind cross-over study, each subject was exposed to both active cannabis (THC) and placebo.
Results
Compared to placebo, cannabis administration was associated with significant increases in plasma levels of ghrelin and leptin, and decreases in PYY, but did not significantly influence insulin levels.
Conclusion
These findings are consistent with modulation of appetite hormones mediated through endogenous cannabinoid receptors, independent of glucose metabolism.
Keywords: THC, cannabinoid, ghrelin, leptin, Peptide YY, PYY, neuroendocrine, Delta-9-Tetrahydrocannabinol; appetite
fuente: Brain Research
doi:10.1016/j.brainres.2011.11.001 |
Autor: Corresponding Author Contact InformationCorresponding author at: 220 Dickinson St., Suite B, San Diego, California 92103. Tel.: + 1 619 543 5079(Voice); fax: + 1 619 543 4744
Nota de la redaccion:
algunos conceptos que relacionan las hormonas del apetito con
los sentidos se describen a continuacion en un PPT en Español de http://www.slideshare.net/AnteroMD/apetito-y-obesidad-presentation
Patricia K. Riggsa, Florin Vaidaa, Steven S. Rossib, Linda S. Sorkinc, Ben Gouauxa, Igor Granta, Ronald J. Ellisa
a HIV Neurobehavioral Research Center (HNRC), University of California, San Diego, USA
b Department of Pediatrics, University of California, San Diego, USA
c Department of Anesthesiology, University of California, San Diego, USA
Received 28 July 2011; revised 18 October 2011; Accepted 2 November 2011. Available online 7 November 2011.
Abstract
Rationale
The endocannabinoid system is under active investigation as a pharmacological target for obesity management due to its role in appetite regulation and metabolism.
Exogenous cannabinoids such as tetrahydrocannabinol (THC) stimulate appetite and food intake.
However, there are no controlled observations directly linking THC to changes of most of the appetite hormones.
Objectives
We took the opportunity afforded by a placebo-controlled trial of smoked medicinal cannabis for HIV-associated neuropathic pain to evaluate the effects of THC on the appetite hormones ghrelin, leptin and PYY, as well as on insulin.
Methods
In this double-blind cross-over study, each subject was exposed to both active cannabis (THC) and placebo.
Results
Compared to placebo, cannabis administration was associated with significant increases in plasma levels of ghrelin and leptin, and decreases in PYY, but did not significantly influence insulin levels.
Conclusion
These findings are consistent with modulation of appetite hormones mediated through endogenous cannabinoid receptors, independent of glucose metabolism.
Keywords: THC, cannabinoid, ghrelin, leptin, Peptide YY, PYY, neuroendocrine, Delta-9-Tetrahydrocannabinol; appetite
fuente: Brain Research
doi:10.1016/j.brainres.2011.11.001 |
Autor: Corresponding Author Contact InformationCorresponding author at: 220 Dickinson St., Suite B, San Diego, California 92103. Tel.: + 1 619 543 5079(Voice); fax: + 1 619 543 4744
Nota de la redaccion:
algunos conceptos que relacionan las hormonas del apetito con
los sentidos se describen a continuacion en un PPT en Español de http://www.slideshare.net/AnteroMD/apetito-y-obesidad-presentation
Apetito Y Obesidad
View more presentations from Antero Vasquez Mejia
La búsqueda de sensaciones , la memoria de reconocimiento y su activación autonómica
Adam L. Lawson, Sarah Gauer, Rebecca Hurst
Departamento de Psicología de la Universidad de Eastern Kentucky, Lexington, KY
La memoria.
fuente de la imagen:prevencion-de-salud.com
resumen
Existe Evidencia sustancial que muestra que la búsqueda de sensaciones impacta a la memoria , sin embargo, no ha estudidado cómo la búsqueda de sensaciones impacta a la familiaridad automatica y a la controlada conscientemente en los sistemas de la memoria.
El presente estudio (N = 80) se examinaron en buscadores de sensaciones alta y baja sensibilidad respecto a la familiaridad y recolección de imágenes del despertar de alta y de baja excitación con valencia negativa utilizando las mediciones de conductancia de la piel y del comportamiento
Los buscadores de sensación baja tuvieron juicios de conocimiento más exacto de las imágenes de despertar de alta excitación de de baja, lo que refleja un sistema motivacional con aversión reforzada.
Buscadores de sensaciones altas mostraron un patrón opuesto, con aumento de la memoria para las imágenes del despertar de baja excitación, independientemente de que la situación fuera vieja o nueva .
La falta de todo efecto de búsqueda de sensaciones en relación con los juicios de recolección de recuerdos sugiere que este rasgo de personalidad es más influenciable en automático que los sistemas de memoria controlada por la conciencia.
Sensation Seeking, Recognition Memory, and Autonomic Arousal
Adam L. Lawson , Sarah Gauer, Rebecca Hurst
Department of Psychology, Eastern Kentucky University, Richmond, KY
Abstract
Substantial evidence shows that sensation seeking impacts memory; however, research has not examined how sensation seeking impacts automatic familiarity and conscious-controlled recollection memory systems.
The present study (N = 80) examined high and low sensation seekers’ familiarity and recollection of high and low arousal images with negative valence using behavioral and skin conductance measures.
Low sensation seekers had more accurate familiarity judgments to high than low arousal images, reflecting a heightened aversive motivational system.
High sensation seekers showed an opposite pattern with memory enhancement for low arousal images, regardless of old-new status.
The lack of any sensation seeking effects in relation to recollection judgments suggests that this personality trait is more influential on automatic than conscious controlled memory systems.
Highlights
► Sensation seeking examined during familiarity and recollection memory. ► Low sensation seekers increased accuracy for high arousal images. ► High sensation seekers memory enhancement for low arousal images. ► Sensation seeking affected familiarity but not recollection.
Keywords: Novelty seeking personality; Old-new effect; Recognition memory; Evoked potentials; Brain imaging; ERP; fMRI
Fuente: "Journal of Research in Personality"
doi:10.1016/j.jrp.2011.10.005 |
Departamento de Psicología de la Universidad de Eastern Kentucky, Lexington, KY
fuente de la imagen:prevencion-de-salud.com
resumen
Existe Evidencia sustancial que muestra que la búsqueda de sensaciones impacta a la memoria , sin embargo, no ha estudidado cómo la búsqueda de sensaciones impacta a la familiaridad automatica y a la controlada conscientemente en los sistemas de la memoria.
El presente estudio (N = 80) se examinaron en buscadores de sensaciones alta y baja sensibilidad respecto a la familiaridad y recolección de imágenes del despertar de alta y de baja excitación con valencia negativa utilizando las mediciones de conductancia de la piel y del comportamiento
Los buscadores de sensación baja tuvieron juicios de conocimiento más exacto de las imágenes de despertar de alta excitación de de baja, lo que refleja un sistema motivacional con aversión reforzada.
Buscadores de sensaciones altas mostraron un patrón opuesto, con aumento de la memoria para las imágenes del despertar de baja excitación, independientemente de que la situación fuera vieja o nueva .
La falta de todo efecto de búsqueda de sensaciones en relación con los juicios de recolección de recuerdos sugiere que este rasgo de personalidad es más influenciable en automático que los sistemas de memoria controlada por la conciencia.
Sensation Seeking, Recognition Memory, and Autonomic Arousal
Adam L. Lawson , Sarah Gauer, Rebecca Hurst
Department of Psychology, Eastern Kentucky University, Richmond, KY
Abstract
Substantial evidence shows that sensation seeking impacts memory; however, research has not examined how sensation seeking impacts automatic familiarity and conscious-controlled recollection memory systems.
The present study (N = 80) examined high and low sensation seekers’ familiarity and recollection of high and low arousal images with negative valence using behavioral and skin conductance measures.
Low sensation seekers had more accurate familiarity judgments to high than low arousal images, reflecting a heightened aversive motivational system.
High sensation seekers showed an opposite pattern with memory enhancement for low arousal images, regardless of old-new status.
The lack of any sensation seeking effects in relation to recollection judgments suggests that this personality trait is more influential on automatic than conscious controlled memory systems.
Highlights
► Sensation seeking examined during familiarity and recollection memory. ► Low sensation seekers increased accuracy for high arousal images. ► High sensation seekers memory enhancement for low arousal images. ► Sensation seeking affected familiarity but not recollection.
Keywords: Novelty seeking personality; Old-new effect; Recognition memory; Evoked potentials; Brain imaging; ERP; fMRI
Fuente: "Journal of Research in Personality"
doi:10.1016/j.jrp.2011.10.005 |
domingo, 13 de noviembre de 2011
AM-101...NOTICIAS POSITIVAS PARA LA ELIMINACION DEL ACUFENO.
Acaba de salir ayer la nueva noticia y positiva del farmaco AM-101 para el acufeno-tinnitus.
les dejo enlace directo y la traduccion.
PD:Lo que me deja un poco pensativo,es eso de hacer los ensayos con personas con acufenos de menos de 3 meses de evolucion.¿Significaria eso que si el farmaco se cormecializa,no valdria para las millones de personas que llevan años con sus acufenos?
http://www.aurismedical.com/p/news/news_31.php?lg=en
17 de octubre 2011
Auris médical informa de los resultados positivos de fase IIb con AM-101 para el tratamiento del tinnitus oído interno aguda
Auris Médico anunció hoy los resultados positivos de un ensayo clínico de fase IIb con AM-101, su fármaco experimental para el tratamiento del tinnitus intratimpánica aguda del oído interno.
El estudio demostró que el tratamiento fue bien tolerado y demostró un efecto estadísticamente significativo.
El estudio doble ciego, aleatorizado, controlado con placebo, paralelo a dosis estudio de fase IIb con AM-101 se con-canalizado en Alemania, Bélgica, Polonia y los Países Bajos, participaron cerca de 30 sitios.
Un total de 248 pacientes que sufren de persistente aguda del oído interno tinnitus fueron aleatorizados a recibir 3 inyecciones intratimpánica de cualquiera de AM-101 a 0,27 o 0,81 mg / ml o placebo durante 3 días consecutivos.
El tinnitus tenía que ser desencadenado por un traumatismo acústico agudo, los medios de comunicación repentina sordera u otitis y no ser mayores de 3 meses.
El ensayo clínico evaluó la tolerancia a la seguridad y locales de AM-101 y los diversos resultados de eficacia.
Los participantes del estudio fueron controlados durante 90 días.
Los resultados preliminares del estudio de fase IIb muestran que el tratamiento local con AM-101 fue bien tolerado, y en particular, que no tuvo un impacto negativo en la audiencia.
Además, el estudio demostró una mejoría dosis-dependiente en varias medidas de tinnitus deterioro, discapacidad y minusvalía.
Los pacientes que sufren de tinnitus aguda con origen establecidas coclear que recibieron AM-101 de 0,81 mg / ml mostraron una reducción estadísticamente significativa en el volumen tinnitus, el impacto del sueño y el THI-12 puntuación del cuestionario (p <0,05 o <0.01). Para más información sobre el ensayo clínico y los resultados detallados se publicarán en una revista científica. "Estamos muy satisfechos con los resultados positivos de este importante ensayo clínico con AM-101", declaró Thomas Meyer, fundador Auris Médico y Director General. "El estudio confirmó la excelente perfil de seguridad del tratamiento y una prueba de concepto para establecer la eficacia en los seres humanos." Agregó que la conclusión exitosa del estudio representa un gran paso adelante en el desarrollo de un tratamiento para el tinnitus oído interno, un área de gran necesidad médica no cubierta. Auris médica es planificar ahora para discutir los resultados del estudio de fase IIb con las agencias reguladoras y de preparar los pasos siguientes para el desarrollo de AM-101. Auris Medical:
Company
Auris Medical was founded in April 2003 in Switzerland.
The company is headquartered in Basel, in the heart of the "Biovalley".
Auris Medical is also working with a network of specialised partners, including some of the world's leading scientists in the area of inner ear disorders.
The company's name derives from Auris, the Latin word for "ear".
Board of Directors and Management
Thomas Meyer
Thomas Meyer - Chairman and Managing Director
Thomas Meyer founded Auris Medical in April 2003, dedicating a substantial share of his personal wealth to this exciting venture.
Before, he had been CEO of Disetronic Group, a leading Swiss supplier of precision infusion and injection systems with approximately 1200 employees. He had been working in various functions for the rapidly growing company since 1988, becoming member of the Board of Directors in 1996, Deputy CEO in 1999 and CEO in early 2000. Prior to joining Disetronic as a member of the Group Management, he had been advising several Swiss companies in the areas of strategy, marketing, and corporate finance.
Thomas Meyer served on the Board of Directors of several other companies in various industries. He holds a PhD in business administration.
Wolfgang Arnold
Wolfgang Arnold - Professor emeritus
Wolfgang Arnold, MD, PhD, is professor emeritus in otolaryngology and head and neck surgery, and an internationally renowned expert in the field of inner ear disorders.
He studied medicine at the University of Munich (Germany), specialized thereafter in otorhinolaryngology in Frankfort, and obtained there his PhD in 1973.
He then worked for 4 years as associate professor at the ENT clinic of the University of Frankfort and for another 4 years in this function at the ENT clinic of the University of Düsseldorf.
In 1981, Wolfgang Arnold was appointed Director of the ENT Clinic of the Kantonsspital Lucerne (Switzerland), and in 1987 additionally professor at the University of Basle.
In 1992 he became Director of the Department of Otolaryngology, Head and Neck Surgery of the Technical University of Munich, Germany (“Klinikum rechts der Isar”), a function he held until his retirement in 2007.
Beside his professional activities, Wolfgang Arnold has also been active as author or editor of numerous scientific articles and books, invited speaker at congresses, and has been a member or honorary member of various medical and scientific associations.
Oliver Kubli - Life science asset manager
Oliver Kubli is a Managing Director and member of the Board of Directors of Adamant Biomedical Investments AG, a Zurich based asset management company specializing in life science investments.
He is Senior Portfolio Manager for the ZKB Pharma Vision Fund, Adamant Global Generika Fund and Adamant Healthcare Trends Fund. Prior to joining Adamant in 2008, Oliver Kubli held various management positions at Zürcher Kantonalbank (ZKB), Switzerland’s third largest bank.
At ZKB, he was Senior Portfolio Manager for several life science funds with investments of more than CHF 1 billion and responsible for the global health care sector within the bank’s Asset Management Division.
Oliver Kubli started his career in the financial sector in the ‘90s as financial analyst and portfolio manager with UBS and Swiss Re. He is a chartered financial analyst (CFA).
Alain Munoz
Alain Munoz - Entrepreneur and consultant
Alain Munoz, MD, PhD, is an entrepreneur and consultant in the healthcare industry. He started his professional career as a cardiologist and anaesthesiologist at the university hospital of Montpellier, France.
In 1983 he switched to the pharmaceutical industry to become head of the cardiovascular department at Sanofi Research.
Two years later, he was appointed Project Leader Cardiovascular and Anti-Thrombotic Products, followed in 1987 by his promotion to Vice President International Development.
In 1990, Alain Munoz moved to privately held Groupe Fournier to become Vice President of Research & Development.
In 1997, he was appointed Senior Vice President of the Pharmaceutical Division. In 2000, he left Fournier to launch his own companies, Amistad Pharma for proprietary drug development, and Science & Business Development for consulting services. Under Alain Munoz' leadership, numerous world-wide leading drugs were developed and approved for marketing (e.g. Lipantyl®, Plavix®) and major licensing deals concluded.
He served for several years on the scientific committee of the French Drug Agency, and is a member of the board of Directors of several biotechnology companies. In addition, Alain Munoz is an adviser to institutional investors; as such, he represents AGF Private Equity on Auris Medical's Board of Directors.
Partners
Collaborations with leading partners in the fields of fundamental and applied research, preclinical and clinical development have always been an important part of Auris Medical's strategy.
We at Auris Medical are focusing primarily on project management.
Since 2003, Auris Medical has been collaborating closely with the Swiss biotechnology company Xigen.
This partner is focusing on research and development of novel intracellular peptide therapeutics. Auris Medical and Xigen have concluded an exclusive license and collaboration agreement for applications in the area of ear disorders.
www.xigenpharma.com
Charles Darwin, Barbra Streisand, Martin Luther, Phil Collins, Beethoven, Ronald Reagan, Cher - all these famous people are known to have suffered or to be suffering from severe hearing loss and / or tinnitus. Vincent van Gogh was also one of them - he supposedly tried to get rid of his tinnitus by cutting off his right ear, as evidenced by his famous selfportrait.
Yet there are not just a few celebrities suffering from inner ear disorders: Joe, Maria, Philippe, Rajiv, Anna, Diego, Mats, Katrin, Chen and many millions of other people around the world are trying to cope with them in their daily lifes - without any truly effective and safe treatment being available.
We at Auris Medical are dedicated to developing novel pharmaceutical therapies (we call them cochlear therapies) to protect hearing and to silence tinnitus.
It is our ambition to provide therapies to prevent or treat important types of hearing loss or of tinnitus in a truly effective and safe way, based on sound science and careful clinical research.
Auris Medical wants to be the leading pioneer in the emerging and exciting field of cochlear therapies.
We have currently two projects under development, AM-101 for the treatment of tinnitus, and AM-111 for the treatment of acute sensorineural hearing loss, as well as several research projects under way.
Inner ear disorders
Hearing loss is either due to insufficient sound conduction from the outer to the inner ear ("conductive hearing loss"), or - much more frequently - to damage to the hair cells and neurons in the cochlea or to the auditory nerve ("sensorineural hearing loss").
The most important causes for sensorineural hearing loss are ageing, acoustic overstimulation by excessive noise or exposure to ototoxic drugs and substances (e.g. certain chemotherapy drugs or antibiotics).
Hearing loss is by far the most prevalent inner ear disorder - according to some estimates, it affects 10% of the population. It is most prevalent among the elderly, with about 30% of people 65 years or older being affected.
However, the incidence is rising rapidly among younger people, mostly due to frequent exposure to excessive noise. At the age of 85 years or older, almost everyone is to some extent affected.
In some cases, the sensorineural hearing loss is acute - e.g. after exposure to loud noise - and may disappear again after a while.
People affected by it may experience a ringing in the ears, and sounds may become muffled for some time.
In most cases however, the hearing loss sets in slowly and progresses insidiously, becoming apparent only after a while.
Sounds may become distorted or muffled, and it may be difficult for the affected person to understand speech especially in noisy situations.
This is due to the irreversible loss of either hair cells or neurons in the cochlea.
At the time of birth, every human being with full auditory capabilities disposes of approximately 3,500 inner hair cells, 13,000 outer hair cells and 30,000 neurons - this number can only decrease in the course of life!
Cochlear therapies
All projects of Auris Medical are focused on the cochlea - which is emphasized by the stylized "medical green" cochlea and the term "cochlear therapies" in the company's logo.
The cochlea is a snail shaped structure ("kokhlias" is the Greek word for snail) that is the sensory organ of hearing.
Together with the adjacent vestibular system, which maintains the body's balance and equilibrium, it forms the inner ear.
The cochlea is a tiny (about the size of a fingernail), yet very powerful organ containing an intricate system of membranes, fluids, specialized sensory cells (hair cells) and neurons.
It converts sounds in a highly fascinating process from mechanical vibrations into electrical signals. These signals code the sound's characteristics and are transmitted to the brain by the auditory nerve.
The idea behind the concept of cochlear therapies is rather simple: to obtain maximum efficacy and avoid unwanted side effects on other parts of the body, pharmaceuticals are used that work specifically on the inner ear disorder and are administered locally, i.e. directly to the cochlea, the site of action.
Local drug delivery is important, as the cochlea - like the brain - is protected by a biological barrier, rendering systemic administration of drugs without severe side effects almost impossible.
Turning the concept of cochlear therapies into therapeutic products represents a major scientific and technical challenge.
Auris Medical has taken up this challenge and aims to make cochlear therapies a reality - to improve the health and quality of life of many people around the world.
News
October 17, 2011 – Auris Medical reporting positive results from phase IIb trial with AM-101 for the treatment of acute inner ear tinnitus
>
March 4, 2011 – AM-111 protects against hearing loss from cochlear implant electrode insertion trauma
>
February 28, 2011 – Auris Medical starting enrolment in first US clinical trial with AM-101
>
February 3, 2011 – Auris Medical completes enrolment in phase IIb trial with AM-101 for the treatment of inner ear tinnitus
>
January 27, 2011 – Phase I/II clinical trial with AM-101 showing good safety in treatment of acute inner ear tinnitus
>
January 17, 2011 – Auris Medical starting enrolment in second cohort of phase IIb study with AM-111
>
November 23, 2010 – Auris Medical receives IND approval from FDA to start clinical trial with AM-101
>
November 19, 2010 – Auris Medical completes enrolment in first cohort of phase IIb study with AM-111
>
August 31, 2010 – Otoprotective effect of AM-111 also shown in cochlear ischemia
>
June 9, 2010 – Oliver Kubli joins Auris Medical’s Board of Directors
>
December 30, 2009 – AM-111 prevents hearing loss from semicircular canal injury in otitis media
>
March 13, 2009 – Auris Medical initiating phase IIb clinical trial with AM-101
>
January 20, 2009 – Auris Medical initiating phase IIb clinical trial with AM-111
>
September 25, 2008 – Auris Medical to present at RNID's Sensory Impairment Conference
>
August 21, 2008 – Auris Medical reporting results of phase I/II clinical trial with AM-101
>
February 15, 2008 – Auris Medical completes series B financing round
>
January 30, 2008 – Auris Medical completing enrolment in phase I/II clinical trial with AM-101
>
January 13, 2008 – New published data show otoprotective effect of AM-111 in case of inner ear inflammatory responses (acute labyrinthitis)
>
February 22, 2007 – Auris Medical initiating phase I/II clinical trial with AM-101
>
February 19, 2007 – New research data suggesting otoprotective effect of AM-111 also in acute labyrinthitis
>
June 21, 2006 – Auris Medical reporting results of a phase I/II clinical trial with AM-111
>
April 13, 2006 – Auris Medical’s AM-111 obtains FDA orphan drug designation for the treatment of acute sensorineural hearing loss
>
February 2, 2006 – Auris presented as innovative young small enterprise in leading French business magazine
>
January 9, 2006 – Auris Medical initiating first clinical trial with AM-111
>
October 14, 2005 – Auris Medical presenting new data on AM-111’s otoprotective efficacy
>
June 23, 2005 – Auris Medical’s AM-111 obtains orphan drug designation for the treatment of acute sensorineural hearing loss in the European Union
>
February 21, 2005 – New data confirms strong otoprotective effect of Auris Medical’s AM-111
>
December 15, 2004 – Auris and Institute for Neuroscience of Montpellier receive award
>
April 8, 2004 – Auris Medical and Institute for Neuroscience of Montpellier enter into collaboration agreement
>
February 4, 2004 – Xigen and Auris Medical enter into collaboration and license agreement
>
January 20, 2004 – Philipp Mekler joins Auris Medical’s Board of Directors
Medical need
Tinnitus and hearing loss may severely reduce the quality of life and health of affected persons. We have been hearing and reading many very touching stories from people who are experiencing severe inner ear disorders and who are encouraging us in our endeavours. While, unfortunately, we cannot provide immediate relief to them as our therapies are still under development, their messages reinforce our determination and motivation.
D. F., France
"I have been suffering from tinnitus since 1993 as a result of a very loud concert. Your work is being followed with the highest attention by thousands, yet hundreds of thousands, if not millions of people affected by tinnitus, since it represents their only real hope. ... There is not one single day, not one hour, not even a minute of relief, my tinnitus reminds me incessantly of its presence, in full awareness, and this is everyday’s fate of all the innumerable people who are suffering from it.”
F. W., Germany
“After four and a half years of complete or partial relief, my tinnitus came back, putting an enomous burden on me. I have real troubles falling asleep etc. The tinnitus is an unbearable pain, ... I’m longing for getting back a life that is worth living.”
P.M. P., France
“I am hard of hearing and have been suffering from tinnitus since many years. ... I’d like to communicate to you that what you’re doing is of extraordinary importance for all those who are in my situation, since in that way we’re keeping up the hope that our tinnitus will cease one day.”
L. M., Sweden
“I have been suffering from tinnitus since I was 20. It began with an ear infection and a mild tinnitus and stayed that way for more than 10 years. When I went to a pub with my friends lately, the noise level was ok when we arrived, but rised as more people arrived. I plugged in my new ear protection, but did not notice that the plug in my bad ear got broken during the evening.
Now I’ve got a terrible tinnitus in my bad ear... Now, the noise level is so loud that I can not work, think or do anything. ... I am willing to try nearly everything to get some part of my sense back.”
R. J., USA
“There are so many, many people who eagerly await a true, genuine, effective treatment for the scourge of tinnitus. Good luck!”
R. V., France
“I’ve learned from your work by reading a report in the periodical of France Acouphènes, the French tinnitus association. I’m suffering terribly from tinnitus and I would like to thank you for what you are doing for us.”
A. K., Israel
“I have been suffering from sudden nerve deafness and tinnitus in my right ear for close to 20 years. I could write a book on my life BEFORE and AFTER tinnitus, ... I have been dreaming and hoping for the past 20 years that someone will find a real and effective cure for tinnitus... Keep up your good work for the sake of mankind.”
Projects
Auris Medical is currently developing two drugs:
AM-101 for the treatment of one of the most frequent types of tinnitus (excitotoxicity in the cochlea e.g. from noise trauma, long noise exposure, vascularisation problems, certain ototoxic drugs etc.)
AM-111 for the treatment of acute sensorineural hearing loss from acute acoustic trauma, sudden deafness or in middle and inner ear surgery
Beside AM-101 and AM-111, Auris Medical is engaged in several other research and development projects, for which no details can be disclosed at this time.
AM-101
Treatment of inner ear tinnitus
A large number of tinnitus cases may be due to single or repeated incidents of excitotoxicity in the cochlea, which can be provoked e.g. by exposure to excessive noise, fluctuations in the blood supply to the cochlea or certain ototoxic medications.
Excitotoxicity leads through the excessive release of the neurotransmitter glutamate to neural degeneration, which may in turn lead to tinnitus.
While the exact mechanisms responsible for the appearance of tinnitus following excitotoxicity remain to be elucidated, it seems highly likely that some dysregulation of cochlear NMDA receptors lies at the heart of the problem. Accumulating evidence suggests that the “phantom sound” is generated by dysregulated NMDA receptors which produce aberrant firing of the auditory nerve.
Frequently asked questions
How does AM-101 work?
AM-101 is a non-competitive antagonist of NMDA receptors which blocks the unwanted activity of NMDA receptors in the cochlea. According to our hypothesis, this can suppress the aberrant excitation of the auditory nerve that is perceived as tinnitus.
For which types of tinnitus could AM-101 work?
Animal studies with AM-101 were performed in a model of tinnitus induced by acoustic trauma, a condition known to trigger glutamate excitotoxicity in the inner ear.
While it does not seem unlikely that AM-101 could also work in case of tinnitus provoked by other triggers of excitotoxicity, we do not know whether this holds true at this point.
Preliminary results from a phase IIb study in humans demonstrated a dose-dependent improvement in various measures of tinnitus impairment, disability and handicap. Patients suffering from acute tinnitus with established cochlear origin who received AM-101 at 0.81 mg/ml showed a statistically significant reduction in tinnitus loudness, sleep impact and the THI-12 questionnaire score (p <0.05 or <0.01). Further information on the clinical trial and detailed outcomes shall be published in a scientific journal. Would AM-101 work only in acute tinnitus? The animal studies with AM-101 were performed in a model of acute acoustic trauma with treatment shortly after tinnitus onset. At this point it is unknown whether there is a therapeutic window during which AM-101 is effective, and if yes, how long such window could last. It seems likely that after some time centralization of tinnitus sets in (i.e. the brain "memorizes" the phantom sound), and a pharmacological treatment of tinnitus in the inner ear may no longer be possible. This question is the subject of much scientific discussion. In general, brain plasticity tends to be more rapid in the type of animals tested than in humans. How is AM-101 administered? AM-101 is administered by intratympanic injection, a slightly invasive and safe procedure that has been known and practiced by ENT doctors for several decades. For the injection, the eardrum is first locally anaesthetized, then slightly perforated with a fine needle through which the drug is administered into the middle ear. During the procedure and for 30 minutes thereafter, patients are lying with their treated ear up. This shall allow for maximum contact of the drug product with the round window membrane - it is throgh this very small membrane that AM-101 then diffuses into the inner ear and reaches its target. After the resting period, patients get up and can go home. How safe is AM-101? Preclinical tests in animals as well as the phase I/II clinical trial showed a good safety profile and local tolerance. In particular no effect on hearing or balance was observed. Thanks to local administration of the drug, only tiny amounts need to be administered. When could AM-101 be available? Like any other investigational drug, AM-101 first has to go through a certain number of clinical trials in order to thoroughly evaluate its safety and efficacy - in accordance with applicable regulations and laws. This process, involving an increasing number of participants at each subsequent study, is taking several years and a precondition for submitting a request for marketing approval. AM-101 will therefore even in the best case not be on the market shortly. It is also important to note that all drug development projects carry a substantial risk of failure, i.e. a great number of investigational products never make it to the market due to unacceptable side effects, lack of efficacy or other reasons. Therefore, market approval and general availability of AM-101 are not certain at this point. How could I participate in a clinical trial with AM-101? We are aware that many people are suffering very badly from their tinnitus and are eager to try out AM-101 by participating in a clinical trial. In fact, we are receiving quite many of such inquiries or requests. Please check first on our website whether a clinical trial is currently open for recruitment or not. In addition, a certain number of well-defined inclusion criteria have to be met for enrolment, while none of the various exclusion criteria are fulfilled. Quite often, interested tinnitus patients are offering to travel very far in order to participate in a clinical trial. However, study documents may not be written in their mother tongue, which excludes them from participation - it is very important and mandatory that all study participants can read and fully understand the information provided by the clinical investigators and that they can express themselves to the investigators. In no case can Auris Medical make any promises regarding the participation in a clinical trial with AM-101 to anyone who is contacting us for this purpose. Thank you for your understanding. AM-111
Treatment of acute sensorineural hearing loss
Acute sensorineural hearing loss from cochlear injury such as exposure to excessive noise (acute acoustic trauma), vascular compromise, bacterial or viral infections of the cochlea (origins of sudden deafness), or middle or inner ear surgery may become permanent when left untreated.
Usually, there is some spontaneous recovery of hearing in the days and weeks following the injury thanks to cochlear repair mechanisms.
However, this recovery may be only partial, depending on the type and degree of injury. In these cases, an irreversible hearing loss remains, equivalent to a life-long handicap.
While ever-more performing hearing aids do provide important relief to people with a hearing loss, they can certainly not restore normal cochlear function and hearing, as destroyed hair cells and neurons of the cochlea won't come back.
AM-111 is a cell-permeable peptide that selectively blocks certain destructive processes in the cochlea.
If applied within a therapeutic window after e.g. some type of the aforementioned hearing injuries, AM-111 can block JNK MAPK mediated apoptosis (i.e. the programmed cell death) of hair cells and cochlear neurons, which would otherwise be lost forever.
This allows to prevent permanent hearing loss and to preserve the precious "auditory capital" at least partially, if not entirely. AM-111’s otoprotective properties have been extensively tested and confirmed in various animal models so far, including acute acoustic trauma, surgery induced acoustic trauma (cochlear implant electrode insertion) and aminoglycoside ototoxicity.
AM-111’s safety has been tested in humans in early 2006 in Germany with a total of 11 patients suffering from acute acoustic trauma (AAT) due to New Year’s firecracker accidents with a hearing loss of at least 30 dB.
Study participants received a single dose of AM-111 at either 2 mg/ml or 0.4 mg/ml in a 250 microlitre gel formulation by transtympanic injection into the most affected ear.
Overall, AM-111 was well tolerated by all study participants, independently of the dose. Adverse events occurred in only small numbers and were either unrelated or considered unlikely related to the treatment.
Regarding AM-111’s efficacy in hearing protecting following ASNHL, the clinical trial provided some first indications of a therapeutic effect of the drug.
A phase IIb clinical trial is currently ongoing in 3 European countries. The study is enrolling patients suffering from acute sensorineural hearing loss either from acute acoustic trauma or idiopathic sudden sensorineural hearing loss.
Trial completion is expected for 2012.
Publications relating to Auris Medical's compounds
Muehlmeier G, Biesinger E, Maier H (2011): Safety of intratympanic injection of AM-101 in patients with acute inner ear tinnitus, Audiology & Neurotology 16, 388-397.
Grindal TC, Sampson EM, Antonelli PJ (2010): AM-111 prevents hearing loss from semicircular canal injury in otitis media, Laryngoscope 120, 178-182.
Barkdull GC, Hondarrague Y, Meyer T, Harris JP, Keithley EM (2007): AM-111 reduces hearing loss in a guinea pig model of acute labyrinthitis, Laryngoscope 117, 2174-2182.
Suckfuell M, Canis M, Strieth S, Scherer H, Haisch A (2007): Intratympanic treatment of acute acoustic trauma with a cell-permeable JNK ligand: a prospective randomized phase I/II study, Acta Oto-Laryngologica 127(9), 938-942.
Wang J, Ruel J, Ladrech S, Bonny C, Van de Water TR, Puel JL (2007): Inhibition of the JNK-mediated mitochondrial cell death pathway restores auditory function in sound exposed animals, Molecular Pharmacology 71(3), 654-666.
Eshraghi AA, Wang J, Adil E, He J, Zine A, Bublik M, Bonny C, Puel JL, Balkany TJ, Van De Water TR (2007): Blocking c-Jun-N-terminal kinase signaling can prevent hearing loss induced by both electrode insertion trauma and neomycin ototoxicity, Hearing Research 226(1-2), 168-177.
Eshraghi AA, He J, Mou CH, Polak M, Zine A, Bonny C, Balkany TJ, Van de Water TR (2006): D-JNKI-1 treatment prevents the progression of hearing loss in a model of cochlear implantation trauma, Otology & Neurotology 27(4), 504-511.
Coleman JK, Littlesunday C, Jackson R, Meyer T (2007): AM-111 protects against permanent hearing loss from acute acoustic trauma, Hearing Research 226, 70-78.
Zine A, Van de Water TR (2004): The MAPK/JNK signalling pathway offers potential therapeutic targets for the prevention of acquired deafness, Current Drug Targets CNS and Neurological Disorders 3(4), 325-332.
Wang J, Ladrech S, Pujol R, Brabet P, Van De Water TR, Puel JL (2004): Caspase inhibitor, but not a c-Jun kinase peptide inhibitor, can prevent cisplatin-induced hearing loss, Cancer Research 64, 9217-9224.
Van De Water TR, Zine A, Eshraghi AA, Mou CH, Wang J, Puel JL, Balkany TJ (2004): Inhibition of the MAPK/JNK signal cascade protects hearing and auditory sensory cells against ototoxins and sound trauma: can it conserve residual hearing during cochlear implantation?, International Congress Series 1273, 72-75.
Wang J, Van De Water TR, Bonny C, Ribaupierre F, Puel JL, Zine A (2003): A peptide inhibitor of c-Jun N-terminal kinase (D-JNKI-1) protects against both aminoglycoside and acoustic trauma-induced auditory hair cell death and hearing loss, J. Neuroscience 23, 8596-8607.
Contact
Auris Medical AG
Aeschenvorstadt 37
4051 Basel
Switzerland
Phone +41 (0)61 201 13 50
Fax +41 (0)61 201 13 51
Auris Medical Inc.
444 North Michigan Ave, Suite 1200
Chicago, IL 60611
USA
Phone +1 312 283 5633
Fax +1 312 283 5005
Impressum / Legal Notice
No warranty and no liability
While Auris Medical is making great efforts to include accurate and up-to-date information, we make no representations or warranties, express or implied, as to the accuracy or completeness of the information provided on this Website and disclaim any liability for the use of this site or any site linked to it.
Auris Medical may change this site at any time without notice but does not assume any responsibility to update it. All users agree that all access and use of this Website and on any Website linked to from this site and the content thereof is at their own risk.
Neither Auris Medical nor any other party involved in creating, producing or delivering this Website or on any Website linked to from this site shall be liable in any manner whatsoever for any direct, incidental, consequential, indirect or punitive damages arising out of your access, use or inability to use this Website or any Website linked to from this site, or any errors or omissions in the content thereof.
Links
Links to third party pages are provided for convenience only.
We do not express any opinion on the content of any third party pages and expressly disclaim any liability for all third party information and the use of it.
Copyright
The Website of Auris Medical and the information contained and referenced therein are for informational purposes only.
Any reproduction, retransmission or other use is strictly prohibited. Request for permission to reproduce any information contained on this Website should be addressed to Auris Medical.
Trademarks
AURIS MEDICAL COCHLEAR THERAPIES, AURILIUM, SILENTIN and ZILENTIN are registered trademarks of Auris Medical AG or related companies or have been filed for official registration in various countries.
Third party sources
Pictures:
"Child with tin can": Corbis; all other pictures except waves, book, cochlear implant as well as portraits: Imagepoint
Picture cochlear implant: courtesy of Med-El, AT-Innsbruck
Hearing loss sample: courtesy of SUVA, CH-Lucerne
Tinnitus sample: courtesy of the foundation for casualty prevention of Winterthur Group, CH-Winterthur
Website
Design: www.haller-artwork.ch
Programming: www.webcan.ch
Fuente:http://boards4.melodysoft.com/acufenos/ultima-noticia-de-aurismedical-en-34827.html
les dejo enlace directo y la traduccion.
PD:Lo que me deja un poco pensativo,es eso de hacer los ensayos con personas con acufenos de menos de 3 meses de evolucion.¿Significaria eso que si el farmaco se cormecializa,no valdria para las millones de personas que llevan años con sus acufenos?
http://www.aurismedical.com/p/news/news_31.php?lg=en
17 de octubre 2011
Auris médical informa de los resultados positivos de fase IIb con AM-101 para el tratamiento del tinnitus oído interno aguda
Auris Médico anunció hoy los resultados positivos de un ensayo clínico de fase IIb con AM-101, su fármaco experimental para el tratamiento del tinnitus intratimpánica aguda del oído interno.
El estudio demostró que el tratamiento fue bien tolerado y demostró un efecto estadísticamente significativo.
El estudio doble ciego, aleatorizado, controlado con placebo, paralelo a dosis estudio de fase IIb con AM-101 se con-canalizado en Alemania, Bélgica, Polonia y los Países Bajos, participaron cerca de 30 sitios.
Un total de 248 pacientes que sufren de persistente aguda del oído interno tinnitus fueron aleatorizados a recibir 3 inyecciones intratimpánica de cualquiera de AM-101 a 0,27 o 0,81 mg / ml o placebo durante 3 días consecutivos.
El tinnitus tenía que ser desencadenado por un traumatismo acústico agudo, los medios de comunicación repentina sordera u otitis y no ser mayores de 3 meses.
El ensayo clínico evaluó la tolerancia a la seguridad y locales de AM-101 y los diversos resultados de eficacia.
Los participantes del estudio fueron controlados durante 90 días.
Los resultados preliminares del estudio de fase IIb muestran que el tratamiento local con AM-101 fue bien tolerado, y en particular, que no tuvo un impacto negativo en la audiencia.
Además, el estudio demostró una mejoría dosis-dependiente en varias medidas de tinnitus deterioro, discapacidad y minusvalía.
Los pacientes que sufren de tinnitus aguda con origen establecidas coclear que recibieron AM-101 de 0,81 mg / ml mostraron una reducción estadísticamente significativa en el volumen tinnitus, el impacto del sueño y el THI-12 puntuación del cuestionario (p <0,05 o <0.01). Para más información sobre el ensayo clínico y los resultados detallados se publicarán en una revista científica. "Estamos muy satisfechos con los resultados positivos de este importante ensayo clínico con AM-101", declaró Thomas Meyer, fundador Auris Médico y Director General. "El estudio confirmó la excelente perfil de seguridad del tratamiento y una prueba de concepto para establecer la eficacia en los seres humanos." Agregó que la conclusión exitosa del estudio representa un gran paso adelante en el desarrollo de un tratamiento para el tinnitus oído interno, un área de gran necesidad médica no cubierta. Auris médica es planificar ahora para discutir los resultados del estudio de fase IIb con las agencias reguladoras y de preparar los pasos siguientes para el desarrollo de AM-101. Auris Medical:
Company
Auris Medical was founded in April 2003 in Switzerland.
The company is headquartered in Basel, in the heart of the "Biovalley".
Auris Medical is also working with a network of specialised partners, including some of the world's leading scientists in the area of inner ear disorders.
The company's name derives from Auris, the Latin word for "ear".
Board of Directors and Management
Thomas Meyer
Thomas Meyer - Chairman and Managing Director
Thomas Meyer founded Auris Medical in April 2003, dedicating a substantial share of his personal wealth to this exciting venture.
Before, he had been CEO of Disetronic Group, a leading Swiss supplier of precision infusion and injection systems with approximately 1200 employees. He had been working in various functions for the rapidly growing company since 1988, becoming member of the Board of Directors in 1996, Deputy CEO in 1999 and CEO in early 2000. Prior to joining Disetronic as a member of the Group Management, he had been advising several Swiss companies in the areas of strategy, marketing, and corporate finance.
Thomas Meyer served on the Board of Directors of several other companies in various industries. He holds a PhD in business administration.
Wolfgang Arnold
Wolfgang Arnold, MD, PhD, is professor emeritus in otolaryngology and head and neck surgery, and an internationally renowned expert in the field of inner ear disorders.
He studied medicine at the University of Munich (Germany), specialized thereafter in otorhinolaryngology in Frankfort, and obtained there his PhD in 1973.
He then worked for 4 years as associate professor at the ENT clinic of the University of Frankfort and for another 4 years in this function at the ENT clinic of the University of Düsseldorf.
In 1981, Wolfgang Arnold was appointed Director of the ENT Clinic of the Kantonsspital Lucerne (Switzerland), and in 1987 additionally professor at the University of Basle.
In 1992 he became Director of the Department of Otolaryngology, Head and Neck Surgery of the Technical University of Munich, Germany (“Klinikum rechts der Isar”), a function he held until his retirement in 2007.
Beside his professional activities, Wolfgang Arnold has also been active as author or editor of numerous scientific articles and books, invited speaker at congresses, and has been a member or honorary member of various medical and scientific associations.
Oliver Kubli - Life science asset manager
He is Senior Portfolio Manager for the ZKB Pharma Vision Fund, Adamant Global Generika Fund and Adamant Healthcare Trends Fund. Prior to joining Adamant in 2008, Oliver Kubli held various management positions at Zürcher Kantonalbank (ZKB), Switzerland’s third largest bank.
At ZKB, he was Senior Portfolio Manager for several life science funds with investments of more than CHF 1 billion and responsible for the global health care sector within the bank’s Asset Management Division.
Oliver Kubli started his career in the financial sector in the ‘90s as financial analyst and portfolio manager with UBS and Swiss Re. He is a chartered financial analyst (CFA).
Alain Munoz
Alain Munoz, MD, PhD, is an entrepreneur and consultant in the healthcare industry. He started his professional career as a cardiologist and anaesthesiologist at the university hospital of Montpellier, France.
In 1983 he switched to the pharmaceutical industry to become head of the cardiovascular department at Sanofi Research.
Two years later, he was appointed Project Leader Cardiovascular and Anti-Thrombotic Products, followed in 1987 by his promotion to Vice President International Development.
In 1990, Alain Munoz moved to privately held Groupe Fournier to become Vice President of Research & Development.
In 1997, he was appointed Senior Vice President of the Pharmaceutical Division. In 2000, he left Fournier to launch his own companies, Amistad Pharma for proprietary drug development, and Science & Business Development for consulting services. Under Alain Munoz' leadership, numerous world-wide leading drugs were developed and approved for marketing (e.g. Lipantyl®, Plavix®) and major licensing deals concluded.
He served for several years on the scientific committee of the French Drug Agency, and is a member of the board of Directors of several biotechnology companies. In addition, Alain Munoz is an adviser to institutional investors; as such, he represents AGF Private Equity on Auris Medical's Board of Directors.
Partners
Collaborations with leading partners in the fields of fundamental and applied research, preclinical and clinical development have always been an important part of Auris Medical's strategy.
We at Auris Medical are focusing primarily on project management.
Since 2003, Auris Medical has been collaborating closely with the Swiss biotechnology company Xigen.
This partner is focusing on research and development of novel intracellular peptide therapeutics. Auris Medical and Xigen have concluded an exclusive license and collaboration agreement for applications in the area of ear disorders.
www.xigenpharma.com
Charles Darwin, Barbra Streisand, Martin Luther, Phil Collins, Beethoven, Ronald Reagan, Cher - all these famous people are known to have suffered or to be suffering from severe hearing loss and / or tinnitus. Vincent van Gogh was also one of them - he supposedly tried to get rid of his tinnitus by cutting off his right ear, as evidenced by his famous selfportrait.
Yet there are not just a few celebrities suffering from inner ear disorders: Joe, Maria, Philippe, Rajiv, Anna, Diego, Mats, Katrin, Chen and many millions of other people around the world are trying to cope with them in their daily lifes - without any truly effective and safe treatment being available.
We at Auris Medical are dedicated to developing novel pharmaceutical therapies (we call them cochlear therapies) to protect hearing and to silence tinnitus.
It is our ambition to provide therapies to prevent or treat important types of hearing loss or of tinnitus in a truly effective and safe way, based on sound science and careful clinical research.
Auris Medical wants to be the leading pioneer in the emerging and exciting field of cochlear therapies.
We have currently two projects under development, AM-101 for the treatment of tinnitus, and AM-111 for the treatment of acute sensorineural hearing loss, as well as several research projects under way.
Inner ear disorders
Hearing loss is either due to insufficient sound conduction from the outer to the inner ear ("conductive hearing loss"), or - much more frequently - to damage to the hair cells and neurons in the cochlea or to the auditory nerve ("sensorineural hearing loss").
The most important causes for sensorineural hearing loss are ageing, acoustic overstimulation by excessive noise or exposure to ototoxic drugs and substances (e.g. certain chemotherapy drugs or antibiotics).
Hearing loss is by far the most prevalent inner ear disorder - according to some estimates, it affects 10% of the population. It is most prevalent among the elderly, with about 30% of people 65 years or older being affected.
However, the incidence is rising rapidly among younger people, mostly due to frequent exposure to excessive noise. At the age of 85 years or older, almost everyone is to some extent affected.
In some cases, the sensorineural hearing loss is acute - e.g. after exposure to loud noise - and may disappear again after a while.
People affected by it may experience a ringing in the ears, and sounds may become muffled for some time.
In most cases however, the hearing loss sets in slowly and progresses insidiously, becoming apparent only after a while.
Sounds may become distorted or muffled, and it may be difficult for the affected person to understand speech especially in noisy situations.
This is due to the irreversible loss of either hair cells or neurons in the cochlea.
At the time of birth, every human being with full auditory capabilities disposes of approximately 3,500 inner hair cells, 13,000 outer hair cells and 30,000 neurons - this number can only decrease in the course of life!
Cochlear therapies
All projects of Auris Medical are focused on the cochlea - which is emphasized by the stylized "medical green" cochlea and the term "cochlear therapies" in the company's logo.
The cochlea is a snail shaped structure ("kokhlias" is the Greek word for snail) that is the sensory organ of hearing.
Together with the adjacent vestibular system, which maintains the body's balance and equilibrium, it forms the inner ear.
The cochlea is a tiny (about the size of a fingernail), yet very powerful organ containing an intricate system of membranes, fluids, specialized sensory cells (hair cells) and neurons.
It converts sounds in a highly fascinating process from mechanical vibrations into electrical signals. These signals code the sound's characteristics and are transmitted to the brain by the auditory nerve.
The idea behind the concept of cochlear therapies is rather simple: to obtain maximum efficacy and avoid unwanted side effects on other parts of the body, pharmaceuticals are used that work specifically on the inner ear disorder and are administered locally, i.e. directly to the cochlea, the site of action.
Local drug delivery is important, as the cochlea - like the brain - is protected by a biological barrier, rendering systemic administration of drugs without severe side effects almost impossible.
Turning the concept of cochlear therapies into therapeutic products represents a major scientific and technical challenge.
Auris Medical has taken up this challenge and aims to make cochlear therapies a reality - to improve the health and quality of life of many people around the world.
News
October 17, 2011 – Auris Medical reporting positive results from phase IIb trial with AM-101 for the treatment of acute inner ear tinnitus
>
March 4, 2011 – AM-111 protects against hearing loss from cochlear implant electrode insertion trauma
>
February 28, 2011 – Auris Medical starting enrolment in first US clinical trial with AM-101
>
February 3, 2011 – Auris Medical completes enrolment in phase IIb trial with AM-101 for the treatment of inner ear tinnitus
>
January 27, 2011 – Phase I/II clinical trial with AM-101 showing good safety in treatment of acute inner ear tinnitus
>
January 17, 2011 – Auris Medical starting enrolment in second cohort of phase IIb study with AM-111
>
November 23, 2010 – Auris Medical receives IND approval from FDA to start clinical trial with AM-101
>
November 19, 2010 – Auris Medical completes enrolment in first cohort of phase IIb study with AM-111
>
August 31, 2010 – Otoprotective effect of AM-111 also shown in cochlear ischemia
>
June 9, 2010 – Oliver Kubli joins Auris Medical’s Board of Directors
>
December 30, 2009 – AM-111 prevents hearing loss from semicircular canal injury in otitis media
>
March 13, 2009 – Auris Medical initiating phase IIb clinical trial with AM-101
>
January 20, 2009 – Auris Medical initiating phase IIb clinical trial with AM-111
>
September 25, 2008 – Auris Medical to present at RNID's Sensory Impairment Conference
>
August 21, 2008 – Auris Medical reporting results of phase I/II clinical trial with AM-101
>
February 15, 2008 – Auris Medical completes series B financing round
>
January 30, 2008 – Auris Medical completing enrolment in phase I/II clinical trial with AM-101
>
January 13, 2008 – New published data show otoprotective effect of AM-111 in case of inner ear inflammatory responses (acute labyrinthitis)
>
February 22, 2007 – Auris Medical initiating phase I/II clinical trial with AM-101
>
February 19, 2007 – New research data suggesting otoprotective effect of AM-111 also in acute labyrinthitis
>
June 21, 2006 – Auris Medical reporting results of a phase I/II clinical trial with AM-111
>
April 13, 2006 – Auris Medical’s AM-111 obtains FDA orphan drug designation for the treatment of acute sensorineural hearing loss
>
February 2, 2006 – Auris presented as innovative young small enterprise in leading French business magazine
>
January 9, 2006 – Auris Medical initiating first clinical trial with AM-111
>
October 14, 2005 – Auris Medical presenting new data on AM-111’s otoprotective efficacy
>
June 23, 2005 – Auris Medical’s AM-111 obtains orphan drug designation for the treatment of acute sensorineural hearing loss in the European Union
>
February 21, 2005 – New data confirms strong otoprotective effect of Auris Medical’s AM-111
>
December 15, 2004 – Auris and Institute for Neuroscience of Montpellier receive award
>
April 8, 2004 – Auris Medical and Institute for Neuroscience of Montpellier enter into collaboration agreement
>
February 4, 2004 – Xigen and Auris Medical enter into collaboration and license agreement
>
January 20, 2004 – Philipp Mekler joins Auris Medical’s Board of Directors
Medical need
Tinnitus and hearing loss may severely reduce the quality of life and health of affected persons. We have been hearing and reading many very touching stories from people who are experiencing severe inner ear disorders and who are encouraging us in our endeavours. While, unfortunately, we cannot provide immediate relief to them as our therapies are still under development, their messages reinforce our determination and motivation.
D. F., France
"I have been suffering from tinnitus since 1993 as a result of a very loud concert. Your work is being followed with the highest attention by thousands, yet hundreds of thousands, if not millions of people affected by tinnitus, since it represents their only real hope. ... There is not one single day, not one hour, not even a minute of relief, my tinnitus reminds me incessantly of its presence, in full awareness, and this is everyday’s fate of all the innumerable people who are suffering from it.”
F. W., Germany
“After four and a half years of complete or partial relief, my tinnitus came back, putting an enomous burden on me. I have real troubles falling asleep etc. The tinnitus is an unbearable pain, ... I’m longing for getting back a life that is worth living.”
P.M. P., France
“I am hard of hearing and have been suffering from tinnitus since many years. ... I’d like to communicate to you that what you’re doing is of extraordinary importance for all those who are in my situation, since in that way we’re keeping up the hope that our tinnitus will cease one day.”
L. M., Sweden
“I have been suffering from tinnitus since I was 20. It began with an ear infection and a mild tinnitus and stayed that way for more than 10 years. When I went to a pub with my friends lately, the noise level was ok when we arrived, but rised as more people arrived. I plugged in my new ear protection, but did not notice that the plug in my bad ear got broken during the evening.
Now I’ve got a terrible tinnitus in my bad ear... Now, the noise level is so loud that I can not work, think or do anything. ... I am willing to try nearly everything to get some part of my sense back.”
R. J., USA
“There are so many, many people who eagerly await a true, genuine, effective treatment for the scourge of tinnitus. Good luck!”
R. V., France
“I’ve learned from your work by reading a report in the periodical of France Acouphènes, the French tinnitus association. I’m suffering terribly from tinnitus and I would like to thank you for what you are doing for us.”
A. K., Israel
“I have been suffering from sudden nerve deafness and tinnitus in my right ear for close to 20 years. I could write a book on my life BEFORE and AFTER tinnitus, ... I have been dreaming and hoping for the past 20 years that someone will find a real and effective cure for tinnitus... Keep up your good work for the sake of mankind.”
Projects
Auris Medical is currently developing two drugs:
AM-101 for the treatment of one of the most frequent types of tinnitus (excitotoxicity in the cochlea e.g. from noise trauma, long noise exposure, vascularisation problems, certain ototoxic drugs etc.)
AM-111 for the treatment of acute sensorineural hearing loss from acute acoustic trauma, sudden deafness or in middle and inner ear surgery
Beside AM-101 and AM-111, Auris Medical is engaged in several other research and development projects, for which no details can be disclosed at this time.
AM-101
Treatment of inner ear tinnitus
A large number of tinnitus cases may be due to single or repeated incidents of excitotoxicity in the cochlea, which can be provoked e.g. by exposure to excessive noise, fluctuations in the blood supply to the cochlea or certain ototoxic medications.
Excitotoxicity leads through the excessive release of the neurotransmitter glutamate to neural degeneration, which may in turn lead to tinnitus.
While the exact mechanisms responsible for the appearance of tinnitus following excitotoxicity remain to be elucidated, it seems highly likely that some dysregulation of cochlear NMDA receptors lies at the heart of the problem. Accumulating evidence suggests that the “phantom sound” is generated by dysregulated NMDA receptors which produce aberrant firing of the auditory nerve.
Frequently asked questions
How does AM-101 work?
AM-101 is a non-competitive antagonist of NMDA receptors which blocks the unwanted activity of NMDA receptors in the cochlea. According to our hypothesis, this can suppress the aberrant excitation of the auditory nerve that is perceived as tinnitus.
For which types of tinnitus could AM-101 work?
Animal studies with AM-101 were performed in a model of tinnitus induced by acoustic trauma, a condition known to trigger glutamate excitotoxicity in the inner ear.
While it does not seem unlikely that AM-101 could also work in case of tinnitus provoked by other triggers of excitotoxicity, we do not know whether this holds true at this point.
Preliminary results from a phase IIb study in humans demonstrated a dose-dependent improvement in various measures of tinnitus impairment, disability and handicap. Patients suffering from acute tinnitus with established cochlear origin who received AM-101 at 0.81 mg/ml showed a statistically significant reduction in tinnitus loudness, sleep impact and the THI-12 questionnaire score (p <0.05 or <0.01). Further information on the clinical trial and detailed outcomes shall be published in a scientific journal. Would AM-101 work only in acute tinnitus? The animal studies with AM-101 were performed in a model of acute acoustic trauma with treatment shortly after tinnitus onset. At this point it is unknown whether there is a therapeutic window during which AM-101 is effective, and if yes, how long such window could last. It seems likely that after some time centralization of tinnitus sets in (i.e. the brain "memorizes" the phantom sound), and a pharmacological treatment of tinnitus in the inner ear may no longer be possible. This question is the subject of much scientific discussion. In general, brain plasticity tends to be more rapid in the type of animals tested than in humans. How is AM-101 administered? AM-101 is administered by intratympanic injection, a slightly invasive and safe procedure that has been known and practiced by ENT doctors for several decades. For the injection, the eardrum is first locally anaesthetized, then slightly perforated with a fine needle through which the drug is administered into the middle ear. During the procedure and for 30 minutes thereafter, patients are lying with their treated ear up. This shall allow for maximum contact of the drug product with the round window membrane - it is throgh this very small membrane that AM-101 then diffuses into the inner ear and reaches its target. After the resting period, patients get up and can go home. How safe is AM-101? Preclinical tests in animals as well as the phase I/II clinical trial showed a good safety profile and local tolerance. In particular no effect on hearing or balance was observed. Thanks to local administration of the drug, only tiny amounts need to be administered. When could AM-101 be available? Like any other investigational drug, AM-101 first has to go through a certain number of clinical trials in order to thoroughly evaluate its safety and efficacy - in accordance with applicable regulations and laws. This process, involving an increasing number of participants at each subsequent study, is taking several years and a precondition for submitting a request for marketing approval. AM-101 will therefore even in the best case not be on the market shortly. It is also important to note that all drug development projects carry a substantial risk of failure, i.e. a great number of investigational products never make it to the market due to unacceptable side effects, lack of efficacy or other reasons. Therefore, market approval and general availability of AM-101 are not certain at this point. How could I participate in a clinical trial with AM-101? We are aware that many people are suffering very badly from their tinnitus and are eager to try out AM-101 by participating in a clinical trial. In fact, we are receiving quite many of such inquiries or requests. Please check first on our website whether a clinical trial is currently open for recruitment or not. In addition, a certain number of well-defined inclusion criteria have to be met for enrolment, while none of the various exclusion criteria are fulfilled. Quite often, interested tinnitus patients are offering to travel very far in order to participate in a clinical trial. However, study documents may not be written in their mother tongue, which excludes them from participation - it is very important and mandatory that all study participants can read and fully understand the information provided by the clinical investigators and that they can express themselves to the investigators. In no case can Auris Medical make any promises regarding the participation in a clinical trial with AM-101 to anyone who is contacting us for this purpose. Thank you for your understanding. AM-111
Treatment of acute sensorineural hearing loss
Acute sensorineural hearing loss from cochlear injury such as exposure to excessive noise (acute acoustic trauma), vascular compromise, bacterial or viral infections of the cochlea (origins of sudden deafness), or middle or inner ear surgery may become permanent when left untreated.
Usually, there is some spontaneous recovery of hearing in the days and weeks following the injury thanks to cochlear repair mechanisms.
However, this recovery may be only partial, depending on the type and degree of injury. In these cases, an irreversible hearing loss remains, equivalent to a life-long handicap.
While ever-more performing hearing aids do provide important relief to people with a hearing loss, they can certainly not restore normal cochlear function and hearing, as destroyed hair cells and neurons of the cochlea won't come back.
AM-111 is a cell-permeable peptide that selectively blocks certain destructive processes in the cochlea.
If applied within a therapeutic window after e.g. some type of the aforementioned hearing injuries, AM-111 can block JNK MAPK mediated apoptosis (i.e. the programmed cell death) of hair cells and cochlear neurons, which would otherwise be lost forever.
This allows to prevent permanent hearing loss and to preserve the precious "auditory capital" at least partially, if not entirely. AM-111’s otoprotective properties have been extensively tested and confirmed in various animal models so far, including acute acoustic trauma, surgery induced acoustic trauma (cochlear implant electrode insertion) and aminoglycoside ototoxicity.
AM-111’s safety has been tested in humans in early 2006 in Germany with a total of 11 patients suffering from acute acoustic trauma (AAT) due to New Year’s firecracker accidents with a hearing loss of at least 30 dB.
Study participants received a single dose of AM-111 at either 2 mg/ml or 0.4 mg/ml in a 250 microlitre gel formulation by transtympanic injection into the most affected ear.
Overall, AM-111 was well tolerated by all study participants, independently of the dose. Adverse events occurred in only small numbers and were either unrelated or considered unlikely related to the treatment.
Regarding AM-111’s efficacy in hearing protecting following ASNHL, the clinical trial provided some first indications of a therapeutic effect of the drug.
A phase IIb clinical trial is currently ongoing in 3 European countries. The study is enrolling patients suffering from acute sensorineural hearing loss either from acute acoustic trauma or idiopathic sudden sensorineural hearing loss.
Trial completion is expected for 2012.
Publications relating to Auris Medical's compounds
Muehlmeier G, Biesinger E, Maier H (2011): Safety of intratympanic injection of AM-101 in patients with acute inner ear tinnitus, Audiology & Neurotology 16, 388-397.
Grindal TC, Sampson EM, Antonelli PJ (2010): AM-111 prevents hearing loss from semicircular canal injury in otitis media, Laryngoscope 120, 178-182.
Barkdull GC, Hondarrague Y, Meyer T, Harris JP, Keithley EM (2007): AM-111 reduces hearing loss in a guinea pig model of acute labyrinthitis, Laryngoscope 117, 2174-2182.
Suckfuell M, Canis M, Strieth S, Scherer H, Haisch A (2007): Intratympanic treatment of acute acoustic trauma with a cell-permeable JNK ligand: a prospective randomized phase I/II study, Acta Oto-Laryngologica 127(9), 938-942.
Wang J, Ruel J, Ladrech S, Bonny C, Van de Water TR, Puel JL (2007): Inhibition of the JNK-mediated mitochondrial cell death pathway restores auditory function in sound exposed animals, Molecular Pharmacology 71(3), 654-666.
Eshraghi AA, Wang J, Adil E, He J, Zine A, Bublik M, Bonny C, Puel JL, Balkany TJ, Van De Water TR (2007): Blocking c-Jun-N-terminal kinase signaling can prevent hearing loss induced by both electrode insertion trauma and neomycin ototoxicity, Hearing Research 226(1-2), 168-177.
Eshraghi AA, He J, Mou CH, Polak M, Zine A, Bonny C, Balkany TJ, Van de Water TR (2006): D-JNKI-1 treatment prevents the progression of hearing loss in a model of cochlear implantation trauma, Otology & Neurotology 27(4), 504-511.
Coleman JK, Littlesunday C, Jackson R, Meyer T (2007): AM-111 protects against permanent hearing loss from acute acoustic trauma, Hearing Research 226, 70-78.
Zine A, Van de Water TR (2004): The MAPK/JNK signalling pathway offers potential therapeutic targets for the prevention of acquired deafness, Current Drug Targets CNS and Neurological Disorders 3(4), 325-332.
Wang J, Ladrech S, Pujol R, Brabet P, Van De Water TR, Puel JL (2004): Caspase inhibitor, but not a c-Jun kinase peptide inhibitor, can prevent cisplatin-induced hearing loss, Cancer Research 64, 9217-9224.
Van De Water TR, Zine A, Eshraghi AA, Mou CH, Wang J, Puel JL, Balkany TJ (2004): Inhibition of the MAPK/JNK signal cascade protects hearing and auditory sensory cells against ototoxins and sound trauma: can it conserve residual hearing during cochlear implantation?, International Congress Series 1273, 72-75.
Wang J, Van De Water TR, Bonny C, Ribaupierre F, Puel JL, Zine A (2003): A peptide inhibitor of c-Jun N-terminal kinase (D-JNKI-1) protects against both aminoglycoside and acoustic trauma-induced auditory hair cell death and hearing loss, J. Neuroscience 23, 8596-8607.
Contact
Auris Medical AG
Aeschenvorstadt 37
4051 Basel
Switzerland
Phone +41 (0)61 201 13 50
Fax +41 (0)61 201 13 51
Auris Medical Inc.
444 North Michigan Ave, Suite 1200
Chicago, IL 60611
USA
Phone +1 312 283 5633
Fax +1 312 283 5005
Impressum / Legal Notice
No warranty and no liability
While Auris Medical is making great efforts to include accurate and up-to-date information, we make no representations or warranties, express or implied, as to the accuracy or completeness of the information provided on this Website and disclaim any liability for the use of this site or any site linked to it.
Auris Medical may change this site at any time without notice but does not assume any responsibility to update it. All users agree that all access and use of this Website and on any Website linked to from this site and the content thereof is at their own risk.
Neither Auris Medical nor any other party involved in creating, producing or delivering this Website or on any Website linked to from this site shall be liable in any manner whatsoever for any direct, incidental, consequential, indirect or punitive damages arising out of your access, use or inability to use this Website or any Website linked to from this site, or any errors or omissions in the content thereof.
Links
Links to third party pages are provided for convenience only.
We do not express any opinion on the content of any third party pages and expressly disclaim any liability for all third party information and the use of it.
Copyright
The Website of Auris Medical and the information contained and referenced therein are for informational purposes only.
Any reproduction, retransmission or other use is strictly prohibited. Request for permission to reproduce any information contained on this Website should be addressed to Auris Medical.
Trademarks
AURIS MEDICAL COCHLEAR THERAPIES, AURILIUM, SILENTIN and ZILENTIN are registered trademarks of Auris Medical AG or related companies or have been filed for official registration in various countries.
Third party sources
Pictures:
"Child with tin can": Corbis; all other pictures except waves, book, cochlear implant as well as portraits: Imagepoint
Picture cochlear implant: courtesy of Med-El, AT-Innsbruck
Hearing loss sample: courtesy of SUVA, CH-Lucerne
Tinnitus sample: courtesy of the foundation for casualty prevention of Winterthur Group, CH-Winterthur
Website
Design: www.haller-artwork.ch
Programming: www.webcan.ch
Fuente:http://boards4.melodysoft.com/acufenos/ultima-noticia-de-aurismedical-en-34827.html
Suscribirse a:
Entradas (Atom)