Association of prepro-orexin polymorphism with obstructive sleep apnea/hypopnea syndrome☆

Original contribution


Weihu Chen MD1, a, Jingying Ye MD1, a, Demin Han MD, PhDCorresponding Author Contact Information, a, E-mail The Corresponding Author, Guoping Yin MDa, Boxuan Wang MSa, Yuhuan Zhanga
a Department of Otorhinolaryngology, Head and Neck Surgery, Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, Beijing, China

Received 23 October 2010; Available online 2 March 2011.
Abstract
Background

Because of the potential role of orexin neuronal circuitry in the regulation of sleep and wakefulness and arousal and breathing, it seems reasonable to speculate that abnormalities in the prepro-orexin gene could be relevant to studies of obstructive sleep apnea/hypopnea syndrome (OSAHS); and it might be a candidate gene in the pathogenesis of OSAHS.
Objective

The present study investigated whether single nucleotide polymorphisms (SNPs) in the human prepro-orexin gene are associated with OSAHS in Han Chinese people.
Methods

A total of 394 subjects (217 cases and 177 control subjects) were recruited from China. Diagnostic polysomnography was performed in all patients and control subjects. SNPs in potentially functional regions of the gene were identified; and genotypes, determined by direct sequencing.
Results

By sequencing the promoter, 2 exons, and the exon-intron junctions of the prepro-orexin gene, the g11182C>T SNP was identified. Statistical analysis showed that there were significant differences in the genotype distribution between patients with OSAHS and the control group (χ22 = 6.437, P = .04). Variant allele T of the g1182C>T polymorphism was more commonly found in patients with OSAHS as compared with control subjects (χ21 = 5.648, P = .017; odds ratio, 1.449; 95% confidence interval, 1.0466–1.968).
Conclusions

Our results suggest that the prepro-orexin gene polymorphism g1182C>T is associated with susceptibility to OSAHS in Han Chinese. This study provides insights into the genetic information for future studies regarding this gene in OSAHS.
Article Outline

1. Introduction
2. Methods
2.1. Patients
2.2. Polysomnography
2.3. Prepro-orexin gene screening
2.4. Statistical analysis
3. Results
3.1. Characteristics and PSG data of subjects
3.2. Frequencies of genotypes and alleles of the polymorphism in patients with OSAHS and control subjects
3.3. Frequencies of genotypes between subgroups classified by BMI
4. Discussion
Acknowledgments
References

1. Introduction

Obstructive sleep apnea/hypopnea syndrome (OSAHS) is a highly prevalent disorder with multiple comorbidities. Overt sleep apnea has been estimated to affect 2% of middle-aged women and 4% of middle-aged men, at least 1% of preschool children, and at least 11% of the elderly [1], [2] and [3]. Its etiology is complex and multifactorial, with evidence that susceptibility is influenced by risk factors that include obesity and obesity-associated traits, craniofacial characteristics associated with reduced upper airway dimensions, as well as ventilatory deficits that predispose to pharyngeal collapsibility during sleep, when neuromuscular output is either reduced or relatively unstable. Although studies of the genetic etiology of the disorder are few, there are growing data that have quantified the heritability of OSAHS, described potential modes of transmission, and have identified suggestive and/or biologically plausible candidate genes [4], [5], [6] and [7].

The excitatory neuropeptide orexin (or hypocretin) is synthesized by neurons restricted to the lateral hypothalamus. Only 2 splice orexin variants (orexin A and orexin B) derived from a unique precursor have been identified, which bind 2 G-protein–coupled receptors (orexin 1 receptor and orexin 2 receptor) [8] and [9]. Orexin neuron projections target a large number of forebrain, limbic, and brainstem nuclei [10] and [11]; and, in turn, they receive inputs from numerous brain nuclei that govern interoceptive and homeostatic signals [12] and [13]. Orexin signaling is involved in the regulation of many neuronal circuits; the most prominent ones control feeding and energy homeostasis [14] and [15] as well as sleep-wake states [16] and [17]. Orexin signaling has also been implicated as regulator of autonomous processes such as emotion and cardiorespiratory functions [18] and [19]. In rodents, canines, and humans, orexin deficiency is associated with narcolepsy characterized by sleep attacks and sleep fragmentation [20].

Preliminary data suggest that orexin levels are abnormal in patients with OSAHS. In one study, morning orexin levels were significantly lower in patients with sleep apnea than in controls [21]. In a repeat study examining orexin levels later in the day, this difference persisted [22]. Another study found low orexin levels in patients with obstructive sleep apnea but also found that reduced orexin levels with obstructive sleep apnea did not correlate with body mass index (BMI), treatment with continuous positive airway pressure, or with daytime hypersomnolence [23]. These relationships suggest that orexin levels may not necessarily be a consequence of the syndrome but instead may be involved in the pathogenesis of obstructive sleep apnea.

It seems reasonable to speculate that abnormalities in the prepro-orexin gene could be relevant to studies of OSAHS because of the potential impact of these neuropeptides on arousal and muscle tone, both of which influence the behavior of respiratory systems, and/or because of the close proximity of these neurons to central respiratory control centers, with potential interactions between arousal and respiratory centers. Therefore, the present study investigated whether the single nucleotide polymorphisms (SNPs) in the human prepro-orexin gene are associated with OSAHS in Han Chinese people.
2. Methods
2.1. Patients

The study sample consisted of 217 patients with OSAHS (157 males and 60 females) diagnosed by using the overnight polysomnography (PSG). The patients who met the diagnostic criteria of OSAHS were recruited from the sleep laboratory of the Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, China. No patients were suspected of having narcolepsy, which is an incurable disorder characterized by excessive sleepiness that typically is associated with episodes of cataplexy. In patients with OSAHS, the mean ± SD age was 50.53 ± 8.57 years; apnea/hypopnea index (AHI), 53.9 ± 16.4 events/h; and BMI, 28.32 ± 4.62 kg/m2, respectively.

A total of 177 healthy control subjects (113 males and 64 females) were screened for a personal or family history to exclude sleep disorders. The mean ± SD age was 48.91 ± 9.45 years; and BMI, 25.17 ± 3.63 kg/m2 in the healthy control group. In these subjects, AHI had to be below 5/h as confirmed by PSG.

All subjects were unrelated Chinese Han individuals. Patients with OSAHS and healthy control subjects were screened to exclude definite psychiatric disorders (axis I disorders of the Diagnostic and Statistical Manual of Mental Disorders) and taking psychotropic medication regularly. General exclusion criteria were drugs influencing the central nervous system; sleep and heart condition; and diseases such as diabetes, acute or ischemic inflammatory liver diseases, thyroid diseases, and acute or chronic renal diseases.

The study was performed in accordance with the Declaration of Helsinki and was approved by the local ethics committee. Written informed consent was given by all participants.
2.2. Polysomnography

All patients with OSAHS and control subjects underwent overnight PSG. PSG consisted of a continuous polygraphic recording electroencephalography (C3/A2, C4/A1), electrooculogram, submental electromyography, right and left anterior tibialis surface electromyography, electrocardiogram, nasal and oral airflow, thoracic and abdominal movements, and oxyhemoglobin saturation. A tracheal microphone was used to detect snoring, and sensors were used to detect the position during sleep. PSG records were interpreted manually according to standard criteria. Apnea episodes were defined as complete cessation of airflow lasting at least 10 seconds. Hypopnea was defined as at least a 50% reduction in airflow for at least 10 seconds accompanied by a reduction in So2 of at least 4%. AHI was defined as the number of events of apnea or hypopnea per hour during sleep time, based on the results of the overnight PSG.
2.3. Prepro-orexin gene screening

The molecular analysis of the prepro-orexin gene was performed using genomic DNA obtained from the peripheral blood by conventional methods. Mutations in the promoter, 2 exons, and exon-intron junctions of prepro-orexin gene were screened by direct sequencing (GenBank accession no. AF118885). The detailed list of primers can be found in Table 1.
Table 1. Primer pairs used in PCRs conducted on prepro-orexin gene
Coding region Forward primer Reverse primer
5′UTR 5′TAGTGGAAAGGGCAGAAG 3′ 5′ATTGTGACCCACTCCCAGG 3′
Exon 1 5′ATCTTAGACTTGCCTTTGTCT 3′ 5′CAAACACAGGCTCTTAGC 3′
Exon 2 5′GGCGCAAAGCAAGGAGAACT3′ 5′GAGTTCCCAGTGCAAGGCCC3′
Nucleotide bases: A, adenine; C, cytosine; G, guanine; T, thymine.

Polymerase chain reaction (PCR) was carried out in a reaction buffer in a total volume of 25 μL, containing 50 ng of genomic DNA, 1 μL deoxyribonucleotide triphosphate, 1 μL proTaq DNA polymerase (Promega Corp, WI), and 0.5μL of each primer. The PCR was performed for 35 cycles of 94°C for 30 seconds, 60°C for 60 seconds, and 72°C for 45 seconds, with initial denaturation at 94°C for 5 minutes and a final extension at 72°C for 3 minutes (GeneAmp PCR System 9700; PE Applied Biosystems, CA). The PCR products were purified; then, sequencing was performed on an Applied Biosystems model 3730 automated sequencer (Applied Biosystems Corp, CA). Sequence data were compared with the published sequence of GenBank accession no. AF118885.
2.4. Statistical analysis

Descriptive characteristics of group variables are expressed as mean ± SD. The significance of variables between groups was tested by unpaired Student t test. Comparison of genotype and allele frequencies between the groups was subsequently carried out using Pearson χ2 test. In addition, the Cochran-Mantel-Haenszel χ2 statistic was used to test for the association of genotype with OSAHS after adjusting for the BMI. All tests were 2-tailed, and significance level was set at P < .05. The statistical analyses were performed using the program Statistical Package for the Social Sciences 16 (SPSS, Inc, Chicago, IL). 3. Results 3.1. Characteristics and PSG data of subjects The characteristics of 217 patients with OSAHS and 177 control subjects in overnight PSG are presented in Table 2. There were no significant differences in age and sex ratio between the 2 groups. Body mass index, AHI, nocturnal mean Sao2, and minimum Sao2 in control subjects were significantly different from the patients with OSAHS. Table 2. Characteristics and PSG data of patients with OSAHS and control subjects Characteristics OSAHS group (n = 217) Control group (n = 177) t P Age (y) 50.53 ± 8.57 48.91 ± 9.45 1.784 .075 Sex⁎ Male 157 113 χ2 = 3.272 .07 Female 60 64 BMI (kg/m2) 28.32 ± 4.62 25.17 ± 3.63 −7.386 <.001 AHI (events/h) 45.46 ± 30.12 1.89 ± 1.45 −19.211 <.001 Mean So2 (%) 89.42 ± 4.32 95.33 ± 2.05 9.038 <.001 Lowest Spo2 (%) 73.97 ± 14.52 91.09 ± 2.77 15.455 <.001 Date are presented as mean ± SD. ⁎ χ2 Analysis (2 × 2 contingency table). 3.2. Frequencies of genotypes and alleles of the polymorphism in patients with OSAHS and control subjects An SNP g1182C>T was identified in the prepro-orexin exon 2. This was a cytosine (C)-thymine (T) SNP 349 base pairs downstream from the initiation of exon 2. Table 3 shows the distribution of the prepro-orexin g1182C>T polymorphism genotypes and alleles in 2 groups. Genotype frequencies of polymorphisms in either OSAHS or control groups were in Hardy-Weinberg equilibrium (P > .05), which suggested that the study sample came from a general population, without any effects of natural selection or migration. Statistical analysis showed that there were significant differences in the genotype distribution between patients with OSAHS and the control group (χ22 = 6.437, P = .04). Variant allele T of the g1182C>T polymorphism was more commonly found in patients with OSAHS as compared with control subjects (χ21 = 5.648; P = .017; odds ratio [OR], 1.449; 95% confidence interval, 1.0466–1.968).
Table 3. Frequencies of genotypes and alleles of the polymorphism in prepro-orexin gene in patients with OSAHS and control subjects
Genotype HWE P Allele
C/C C/T T/T C T
OSAHS (n = 217) 85 (39.2) 112 (51.6) 20 (9.2) .347 282 (65.0) 152 (35.0)
Control (n = 177) 91 (51.4) 76 (42.9) 10 (5.6) .709 258 (72.9) 96 (27.1)
χ2 6.437 5.648
P .04 .017
OR⁎ 1.449 (1.066–1.968)
Data are presented as n (%). χ2 Analysis (R × C contingency table). HWE indicates Hardy-Weinberg equilibrium.
⁎ OR: for the the T allele.
3.3. Frequencies of genotypes between subgroups classified by BMI

The standard Cochran-Mantel-Haenszel χ2 test was used to test for association between SNP and OSAHS in an attempt to control for differences in BMI between the 2 groups. All 394 subjects were classified into 2 subgroups according to a BMI cutoff point of 30 kg/m2: obese subjects (BMI, >30 kg/m2; n = 110) and nonobese subjects (BMI, <30 kg/m2; n = 284). Results of the analysis also indicated a strong association between the SNP and OSAHS while controlling for BMI (χ2 = 5.412; P = .020; common OR,1.643; 95% confidence interval, 1.1–2.455) (Table 4). Table 4. Frequencies of genotypes of the prepro-orexin gene polymorphism between subgroups classified by BMI within subjects Nonobese subjects Obese subjects OSAHS Control Total OSAHS Control Total C/T+T/T 83 (51.23) 79 (48.77) 162 49 (87.5) 7 (12.5) 56 C/C 47 (38.5) 75 (61.5) 122 38 (70.37) 16 (29.63) 54 χ2 4.529 4.878 P 0.033 0.027 OR 1.677 (1.04–2.702) 2.947 (1.102–7.885) Cochran χ21 5.911 P .015 Mantel-Haenszel χ21 5.412 P .020 Common OR 1.643 (1.1–2.455) Data are presented as n (%); obese subjects (BMI, >30 kg/m2) and nonobese subjects (BMI, <30 kg/m2). We also performed direct sequencing analysis of the promoter/exon-1 region in patients with OSAHS and healthy controls. No other polymorphisms were found in any subject. 4. Discussion The present study is the first report on the association of OSAHS with g1182C>T, a genetic variant in the exon 2 of the prepro-orexin gene. Both genotype (C/T) and allele (T) of the g1182C>T SNP have significant association with OSAHS.

The prepro-orexin gene, on human chromosome 17q21–22, consists of 2 exons and 1 intron. Exon 2 encodes a propeptide from which the orexins A and B are cleaved proteolytically [24]. The pleiotropic effects of orexin are not only on appetite regulation but also on sleep architecture [25]. The prepro-orexin gene is expressed in a variety of brain areas that are important for the regulation of breathing, and the roles of orexin in neural control of the sleep-wake cycle have direct implications in OSAHS. The previous studies on orexin knockout mice have shed light on a direct role of orexin in cardiorespiratory control [18]. Orexin knockout mice show an excessive daytime sleepiness phenotype with instability in their arousal states [26] and exaggerated sleep apneas [27]. Besides an attenuated hypercapnic chemoreflex [28], orexin deficiency in mice impairs long-term facilitation of respiratory motor outputs in response to intermittent hypoxia [29].

In addition, orexin may exert a control of the genioglossus muscle activity that has a major role in OSAHS. Animal studies showed that orexin neurons can excite hypoglossal motoneurons through direct projections. In addition, hypoglossal premotoneurons have been identified in the Kölliker-Fuse [30], and orexin B microinjected in the Kölliker-Fuse nucleus enhances preinspiratory activity of the hypoglossal nerve [31]. Therefore, orexin deficiency can result in decreased excitability of genioglossus motoneurons; and lacking orexin excitatory drive to hypoglossal premotoneurons in the Kölliker-Fuse nucleus could diminish the preinspiratory protrusion of the tongue, which is physiologically required to reduce upper airway resistance before the active inspiratory phase. This can undoubtedly increase the risk of hypoglossal-related upper airway obstruction in orexin knockout mice.

Although the association between prepro-orexin g1128C>T and OSAHS appears solid, its functional implications are currently poorly understood. It is entirely unclear whether this C/T nucleotide exchange substitution affects ligand binding, effector coupling, or desensitization of the orexins A and B. A careful analysis of the prepro-orexin gene and the definition of haplotypes are required to further investigate the functional significance of this polymorphism.

Because all of our subjects were assessed by overnight PSG, an established diagnostic method for OSAHS, we assume these findings are valid. However, some issues need to be addressed. First, although the association with the prepro-orexin gene is based on an SNP in the translated region, how this SNP or its adjacent region relates to OSAHS is difficult to understand at this stage and requires further study. Second, we did not find the other SNP in prepro-orexin gene, including IVS1+16T>C, rs9902709, −909T/C, −22C/T and −20C/A polymorphisms, which were identified in previous studies [32], [33] and [34]. A possible reason for the discrepant results may be the difference of the studied racial populations. Further studies on orexin in larger populations and different races of people, as well as animal studies, if animal models of sleep apnea-hypopnea syndrome are available, would help to clarify the fact on orexin system in patients with OSAHS.

In conclusion, our finding of a genetic variant in the prepro-orexin gene provides a new possible candidate gene for OSAHS. Further work is required to study the extent of the haplotype in prepro-orexin gene involved. Additional replication in larger samples is necessary, including comparison with ongoing genome-wide association studies. The identification of a significant association between the prepro-orexin gene and OSAHS, with possible involvement in excessive daytime sleepiness, ventilator control, and upper airway patency, may have important clinical implications and warrants further study of the orexin in OSAHS.
Acknowledgments

Author contributions: Demin Han, conception, design, acquisition of data, analysis, interpretation, drafting, final approval; Weihu Chen, acquisition of data, analysis, final approval, manuscript preparation; Jingying Ye, design, acquisition of data, analysis, final approval, manuscript preparation; Guoping Yin, acquisition of data, final approval; Boxuan Wang, acquisition of data, final approval; Yuhuan, Zhang, acquisition of data, final approval.

The authors thank the laboratory staff of the Chinese National Human Genome Center, Beijing, China.

This work was supported by the National Natural Science Foundation of China (Grant no. 30730100).

Financial/nonfinancial disclosures: The authors have reported to the American College of Chest Physicians that no significant conflicts of interest exist with any companies/organizations whose products or services may be discussed in this article.
References

[1] T. Young, M. Palta and J. Dempsey, et al. The occurrence of sleep-disordered breathing among middle-aged adults. N Engl J Med, 328 (1993), pp. 1230–1235. | View Record in Scopus | | Cited By in Scopus (4017)

[2] C. Gilleminault and R. Pelayo, Sleep-disordered breathing in children. Ann Med, 30 (1998), pp. 350–356.

[3] J.P. Janssens, S. Pautex and H. Hilleret, et al. Sleep disordered breathing in the elderly. Aging, 12 (2000), pp. 417–429. | View Record in Scopus | | Cited By in Scopus (28)

[4] A. Barcelo, M.A. Elorza and F. Barbe, et al. Angiotensin converting enzyme in patients with sleep apnoea syndrome: plasma activity and gene polymorphisms. Eur Respir J, 17 (2001), pp. 728–732. | View Record in Scopus | | Cited By in Scopus (28)

[5] L.J. Palmer, S.G. Buxbaum and E.K. Larkin, et al. Whole genome scan for obstructive sleep apnea and obesity in African-American families. Am J Respir Crit Care Med, 169 (2004), pp. 1314–1321.

[6] K. Sakai, T. Takada and H. Nakayama, et al. Serotonin-2A and 2C receptor gene polymorphisms in Japanese patients with obstructive sleep apnea. Intern Med, 44 (2005), pp. 928–933.

[7] R.L. Riha, P. Brander and M. Vennelle, et al. Tumour necrosis factor-alpha (-308) gene polymorphism in obstructive sleep apnoeaehypopnoea syndrome. Eur Respir J, 26 (2005), pp. 673–678.

[8] L. De Lecea, T.S. Kilduff and C. Peyron, et al. The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A, 95 (1998), pp. 322–327.

[9] T. Sakurai, A. Amemiya and M. Ishii, et al. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G-coupled receptors that regulate feeding behavior. Cell, 92 (1998), pp. 573–585.

[10] C. Peyron, D.K. Tighe and A.N. van den Pol, et al. Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci, 18 (1998), pp. 9996–10015.

[11] J.P. Nixon and S. Smale, A comparative analysis of the distribution of immunoreactive orexin A and B in the brains of nocturnal and diurnal rodents. Behav Brain Funct, 3 (2007), p. 28.

[12] K. Yoshida, S. McCormack and R.A. Espanña, et al. Afferents to the orexin neurons of the rat brain. J Comp Neurol, 494 (2006), pp. 845–861.

[13] T. Sakurai, R. Nagata and A. Yamanaka, et al. Input of orexin/hypocretin neurons revealed by a genetically encoded tracer in mice. Neuron, 46 (2005), pp. 297–308.

[14] N.C. Tkacs, Y. Pan and G. Sawhney, et al. Hypoglycemia activates arousal-related neurons and increases wake time in adult rats. Physiol Behav, 91 (2007), pp. 240–249.

[15] H. Ganjavi and C.M. Shapiro, Hypocretin/orexin: a molecular link between sleep, energy regulation, and pleasure. J Neuropsychiatry Clin Neurosci, 19 (2007), pp. 413–419.

[16] K. Ohno and T. Sakurai, Orexin neuronal circuitry: role in the regulation of sleep and wakefulness. Front Neuroendocrinol, 29 (2008), pp. 70–87.

[17] C.G. Diniz Behn, N. Kopell and E.N. Brown, et al. Delayed orexin signaling consolidates wakefulness and sleep: physiology and modeling. J Neurophysiol, 99 (2008), pp. 3090–3103.

[18] T. Kuwaki, W. Zhang and A. Nakamura, et al. Emotional and state-dependent modification of cardiorespiratory function: role of orexinergic neurons. Auton Neurosci, 142 (2008), pp. 11–16.

[19] T. Kuwaki, Orexinergic modulation of breathing across vigilance states. Respir Physiol Neurobiol, 164 (2008), pp. 204–212.

[20] S. Nishino, Clinical and neurobiological aspects of narcolepsy. Sleep Med, 8 (2007), pp. 373–399.

[21] T. Nishijima, S. Sakurai and Z. Arihara, et al. Plasma orexin-A–like immunoreactivity in patients with sleep apnea hypopnea syndrome. Peptides, 24 (2003), pp. 407–411.

[22] S. Sakurai, T. Nishijima and S. Takahashi, et al. Clinical significance of daytime plasma orexin-A–like immunoreactivity concentrations in patients with obstructive sleep apnea hypopnea syndrome. Respiration, 71 (2004), pp. 380–384.

[23] X. Busquets, F. Barbe and A. Barcelo, et al. Decreased plasma levels of orexin-A in sleep apnea. Respiration, 71 (2004), pp. 575–579.

[24] T. Sakurai, T. Moriguchi and K. Furuya, et al. Structure and function of human prepro-orexin gene. J Biol Chem, 74 (1999), pp. 17771–17776.

[25] J. Lu, D. Sherman and M. Devor, et al. A putative flip-flop switch for control of REM sleep. Nature, 441 (2006), pp. 589–594.

[26] T. Mochizuki, A. Crocker and S. McCormack, et al. Behavioral state instability in orexin knockout mice. J Neurosci, 24 (2004), pp. 6291–6300.

[27] A. Nakamura, W. Zhang and M. Yanagisawa, et al. Vigilance state-dependent attenuation of chemoreflex and exaggerated sleep apnea in orexin knockout mice. J Appl Physiol, 102 (2007), pp. 241–248.

[28] B.S. Deng, A. Nakamura and W. Zhang, et al. Contribution of orexin in hypercapnic chemoreflex: evidence from genetic and pharmacological disruption and supplementation studies in mice. J Appl Physiol, 103 (2007), pp. 1772–1779.

[29] J. Terada, A. Nakamura and W. Zhang, et al. Ventilatory long-term facilitation in mice can be observed both during sleep and wake periods and depends on orexin. J Appl Physiol, 104 (2008), pp. 499–507. | View Record in Scopus | | Cited By in Scopus (27)

[30] C. Gestreau, M. Dutschmann and S. Obled, et al. Activation of hypoglossal motor and premotor neurons during various oropharyngeal behaviors. Respir Physiol Neurobiol, 147 (2005), pp. 159–176. Article | PDF (643 K) | | View Record in Scopus | | Cited By in Scopus (40)

[31] M. Dutschmann, M. Kron and M. Mörschel, et al. Activation of orexin B receptors in the pontine Kölliker-Fuse nucleus modulates preinspiratory hypoglossal motor activity in rat. Respir Physiol Neurobiol, 159 (2007), pp. 232–235. Article | PDF (352 K) | | View Record in Scopus | | Cited By in Scopus (15)

[32] M. Hungs, L. Lin and M. Okun, et al. Polymorphisms in the vicinity of the hypocretin/orexin gene are not associated with human narcolepsy. Neurology, 57 (2001), pp. 1893–1895. | View Record in Scopus | | Cited By in Scopus (30)

[33] M. Gencik, N. Dahmen and S. Wieczorek, et al. A prepro-orexin gene polymorphism is associated with narcolepsy. Neurology, 56 (2001), pp. 115–117. | View Record in Scopus | | Cited By in Scopus (42)

[34] I. Rissling, Y. Körner and F. Geller, et al. Preprohypocretin polymorphisms in Parkinson disease patients reporting “sleep attacks”. Sleep, 28 (2005), pp. 871–875. | View Record in Scopus | | Cited By in Scopus (15)

☆The source of financial support: This work was supported by the National Natural Science Foundation of China (Grant no. 30730100).


Corresponding Author Contact InformationCorresponding author. Department of Otorhinolaryngology, Head and Neck Surgery, Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, Beijing 100730, China. Tel.: +86 10 58265782; fax: +86 10 65131244.

1Co–first author: Chen Weihu, MD, and Ye Jingying, MD, contributed equally to this work.

American Journal of Otolaryngology
Volume 33, Issue 1, January-February 2012, Pages 31-36